THEORETICAL STUDY ON ROUGHNESS FACTORS OF INVOLUTE SPUR GEAR TRANSMISSION by GAO ChuangKuan, ZHOU ZhongKe

“…At the end,several theoretical formulas for determining the roughness factors are created based on the multiple regression analysis of the above calculated results.…”
Get full text

Effect of Roasting on the Proximate Composition, Antioxidant Activity, and Functional Properties of Afrostyrax lepidophyllus (Country Onion) Seeds by Wiyeh Claudette Bakisu Muala, Tonfack Djikeng Fabrice, Noumo Ngangmou Thierry, Ngangoum Eric Serge

“…Afrostyrax lepidophyllus seed is a nontimber forest product which has a strongly ferocious smell of garlic or onion. …”
Get full text

Las juventudes trabajadoras en el comercio minorista tradicional: gestión, control y resistencias by Francisco Nicolás Favieri

“… La flexibilización de las condiciones de trabajo y contratación junto con la aparición de nuevas formas de control y gestión del proceso de trabajo han contribuido a la aparición de nuevas formas de empleo, siendo el sector de servicios y en particular el comercio minorista uno de los que más diversificaciones han presentado en los últimos años. …”
Get full text

Ultrasound-Assisted Optimal Development and Characterization of Stevia-Sweetened Functional Beverage by Muhammad Kamran Khan, Muhammad Naveed Asif, Muhammad Haseeb Ahmad, Muhammad Imran, Muhammad Sajid Arshad, Sadia Hassan, Muhammad Imran Khan, Mahr-un Nisa, Muhammad Mohsin Iqbal, Niaz Muhammad

“…For this purpose, juices of apple and carrot along with the extract of stevia leaves underwent the process optimization using a statistical approach of D-optimal mixture design. The best beverage formulation with high sensory scores was composed of apple juice 70%, carrot juice 27%, and stevia extract (5 g/100 ml) 3%. …”
Get full text

Rain removal method for single image of dual-branch joint network based on sparse transformer by Fangfang Qin, Zongpu Jia, Xiaoyan Pang, Shan Zhao

“…The developed model comprises a rain removal subnet and a background recovery subnet. The former extracts rain trace information utilizing a rain removal strategy, while the latter employs this information to restore background details. …”
Get full text

Projeto pingo de luz: um relato de experiência com pacientes em cuidados paliativos. by Gustavo Alberto Pereira de Moura, Iury C. P. Cavalcanti, Sávio M. de Borba

“…Os serviços oferecidos pelo referido Projeto se mostraram significativos na melhora do quadro em que o paciente estava quando se iniciaram os acompanhamentos, não somente na forma de lidar com o sofrimento psíquico, para além disso, uma melhora no aspecto fisiológico. …”
Get full text

Las ciencias de la información y de la comunicación: ¿una particularidad disciplinaria? by Carlos González Domínguez

“…Sin embargo, y gracias a una permanente vigilancia epistemológica, toda disciplina debe actualizar sus objetos, teorías, métodos y hasta técnicas, ya que toda ciencia se debe a una historia y a proyectos humanos, es decir a las formas de problematizar los objetos de estudio. En este contexto, las ciencias de la información y de la comunicación, desde la complejidad de su episteme, no se diferencian del resto de las disciplinas de las ciencias sociales e incluso de las ciencias llamadas duras.…”
Get full text

The BLUP method in evaluation of breeding values of Russian spring wheat lines using micro- and macroelements in seeds by N. A. Potapova, A. S. Zlobin, I. N. Leonova, E. A. Salina, Y. A. Tsepilov

“…The measured breeding value (BV) for varieties and breeds in relation to the target trait allows breeding stages to be thoroughly planned and the parent forms suitable for crossing to be chosen. In this work, the BLUP method was used to assess the breeding value of 149 Russian varieties and introgression lines (4 measurements for each variety or line, 596 phenotypic points) of spring wheat according to the content of seven chemical elements in the grain – K, Ca, Mg, Mn, Fe, Zn, Cu. …”
Get full text

Scientific support of competition development processes in power market by V. Ya. Afanasyev, V. V. Kuzmin, I. N. Ivanov

“…The market has not yet managed to create any acceptable competition conditions, forming systemic conditions for a noticeable increase in the entrepreneurship efficiency. …”
Get full text

The physics-based deterministic scenarios for earthquake hazards and losses of the Zhujiangkou fault in southern China by Yilong Li, Houyun Yu, Ming Wang, Xiuwei Ye, Kai Liu, Zhenguo Zhang, Wei Zhang, Xiaofei Chen

“…The rupture directivity effect, driven by seismic wave interferences in forward propagation, leads to stark differences in hazards and losses across urban agglomerations, even under similar fault conditions. …”
Get full text

Carbothermic reduction of electric arc furnace dust and calcination of waelz oxide by semi-pilot scale rotary furnace by Morcali M.H., Yucel O., Aydin A., Derin B.

“…Activation energies were 242.77 kJ/mol for the zinc recovery with powder forms, 261.99 kJ/mol for the zinc recovery with pellet forms respectively. …”
Get full text

Phytochemical composition, phytotoxicity, and ADME modeling of Artemisia absinthium L.: implications for food safety and pharmaceutical applications by Asmae Hbika, Ayoub Farihi, Mohammed Benali, Fatima-Zahrae Ed-darraz, Abdelhamid Bouyanzer, Mohammed F. Hawwal, Ramzi A. Mothana, Elkhadir Gharibi

“…The primary minerals in Artemisia absinthium stems are potassium (41%) and calcium (38.3%), forming most of its mineral content. The ethanolic extract exhibited the highest phenolic compound content, with 37.6 ± 0.09 mg GAE/g DE. …”
Get full text

Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq by Berivan A. Latef, Luay A. Ali

“…PCR product of COI was sequenced using forward primer COI F 5'(ACCCGCTGAATTTAAGCAT)3' and reverse primer COIR 5'( CTCTTCAGATACTTTTCAAC) 3' then registered  in the GenBank database with their accession numbers. …”
Get full text

The Influencers and the Adoption of New Products: Model for the Influencer Marketing by Henen Oulhi

“…Due to the broad scope of the study population, the researcher adopted a simple random sampling technique, with the sample size determined using Richard Geiger’s formula, resulting in a representative sample of 384 participants. …”
Get full text

Vänner och fiender til kriminalstatistiken by Veli Verkko

“…En fortsättning på uppsatsen "Kriminalstatistiken och frågan om viljans frihet".…”
Get full text

Augmenting flexibility: mutual inhibition between inhibitory neurons expands functional diversity by Belle Liu, Alexander James White, Chung-Chuan Lo

“…These CRIRELs have the advantage of being both multi-functional and controllable, performing a plethora of functions, including decisions, memory, toggle, and so forth. Finally, we demonstrate how mutual inhibition maximizes storage capacity for larger networks.…”
Get full text

The role of morphological adaptability in Vibrio cholerae’s motility by Jun Xu, Keigo Abe, Toshio Kodama, Marzia Sultana, Denise Chac, Susan M. Markiewicz, Hideyuki Matsunami, Erika Kuba, Shiyu Tsunoda, Munirul Alam, Ana A. Weil, Shuichi Nakamura, Tetsu Yamashiro

“…This study examines the motility differences between filamentous and comma-shaped forms of the V. cholerae O1 strain under various viscosity conditions. …”
Get full text

Florida Cow-Calf and Stocker Beef Safety and Quality Assurance Handbook: Record Keeping for Beef Quality Assurance by Todd A. Thrift, Matt J. Hersom, Max Irsik

“…It includes examples of forms and a table with record keeping requirements of relevant state and federal laws. …”
Get full text

Russian Science Directive Leaves Researchers Cold by Shauna M. Haley

“…Both Nature and Science lead the news week with coverage of Russia’s new science directive: that all contacts made by Russian researchers with foreigners be reported in detail.…”
Get full text

Comparison of Coupled and Uncoupled Modeling of Floating Wind Farms with Shared Anchors by Katherine Coughlan, Ericka Lozon, Matthew Hall, Bruce Martin, Sanjay Arwade

“…While the two methods produce broadly comparable results, the coupled wave loading on platforms within the farm results in wave force cancellations and amplifications that decrease multiline force directional ranges and increase multiline force extreme values (up to 7%) and standard deviations (up to 11%) for wave-driven load cases. …”
Get full text