Bacterial Profile and Antibiotic Susceptibility Pattern of Urinary Tract Infection among Pregnant Women Attending Antenatal Care at a Tertiary Care Hospital in Southern Ethiopia by Ashenafi Tula, Abraham Mikru, Tsegaye Alemayehu, Beyene Dobo

“…Midstream urine was collected from pregnant women using sterile containers. Culture and sensitivity were performed using a standard operating procedure of the microbiology laboratory. …”
Get full text

Enhancing Camera Source Identification: A Rapid Algorithm with Enhanced Discriminative Power by Zhimao Lai, Lijuan Cheng, Renhai Feng

“…Experimental results show that in a database containing fingerprints from 70 cameras, our algorithm is 50% faster in average search time than BFSA, and its matching accuracy rate exceeds 90% under various noise levels. …”
Get full text

Nitrification and denitrification in pond by Yuni Puji Pujihastuti

“…Five process of nitrogen biogeochemical cycle in the container cultivation is the amonification, nitrification, nitrogen assimilation, denitrification and nitrogen fixation. …”
Get full text

Effects of Probiotic Bacillus sp. on Food Convertion and Growth of Catfish Pangasius hypophthalmus by Dedi Jusadi, E. Gandara, Ing Mokoginta

“…Prior the feeding, probiotic (contained Bacillus sp. 4,2x106 CFU.ml-1) were added into the diet at a dosage of 0, 5, 15 or 25 ml.kg-1 diet. …”
Get full text

Evaluation of a Global Initiative for Asthma Education and Implementation Program to Improve Asthma Care Quality (CARE4ALL): Protocol for a Multicenter, Single-Arm Study by Kewu Huang, Wenjun Wang, Ying Wang, Yanming Li, Xiaokai Feng, Huahao Shen, Chen Wang

“…Implementing evidence-based management as recommended by the Global Initiative for Asthma (GINA), especially introducing inhaled corticosteroid–containing treatments, has the potential to vastly reduce exacerbations and the high burden of asthma in China. …”
Get full text

Biomass and Yield in Solanum lycopersicum Expressing a Synthetic Photorespiration Pathway by Laura Dougherty, Bret Cooper, James Bunce, Bryan Vinyard, John Stommel

“…The tomato cultivar Moneymaker was transformed with a synthetic photorespiration pathway construct containing a Cucurbita maxima malate synthase (MS) gene and a Chlamydomonas reinhardtii glycolate dehydrogenase (CrGDH) gene targeted to the chloroplast, with a plastid glycolate-glycerate translocator 1 (PLGG1) hairpin interference construct targeting the native photorespiratory pathway. …”
Get full text

Could Infectious Agents Play a Role in the Onset of Age-related Macular Degeneration? A Scoping Review by Petra P. Larsen, MD, PhD, Virginie Dinet, PhD, Cécile Delcourt, PhD, Catherine Helmer, MD, PhD, Morgane Linard, MD, PhD

“…Clinical relevance: Age-related macular degeneration is a multifactorial disease and the leading cause of vision loss among older adults in developed countries. Clarifying whether certain infections participate in its onset or progression seems essential, given the potential implications for treatment and prevention. …”
Get full text

Scalable production of bio-calcium oxide via thermal decomposition of solid - hatchery waste in a laboratory-scale rotary kiln by Suwanan Chuakham, Ajchara I. Putkham, Yuwadee Chaiyachet, Arnusorn Saengprajak, Kriangsak Banlue, Nipon Tanpaiboonkul, Apipong Putkham

“…Moreover, the production of bio-CaO with eggshells containing eggshell membrane decreases the purity of calcium oxide by about 0.7–1.0%. …”
Get full text

Lactococcus lactis D4 Decreases NF-κB and α-SMA in Rat Models of Obstructive Jaundice by Avit Suchitra, Alvarino Alvarino, Eryati Darwin, Harnavi Harun, Muhammad Iqbal Rivai, Ade Sukma

“…The rats were maintained for 7–10 days, with the rats in BDL+LLD4 group received fermented milk containing LLD4 via gavage at a dose of 112 mg/20 gBW per day for 7 days. …”
Get full text

Analisis Metode Estimasi Biaya pada Perangkat Lunak Beserta Faktor-Faktor yang Mempengaruhi : A Systematic Literature Review by Amelia Devi Putri Ariyanto, Lutfiyatul ‘Azizah, Umi Laili Yuhana

“…The purpose of this study is to create a Systematic Literature Review (SLR) which contains a summary and analysis of the latest research developments on cost estimation in software, especially in the methods used and the factors that affect cost estimation. …”
Get full text

Descripción de la estructura familiar de una muestra de pacientes con hemofilia. Comparación Argentina-México / Description of a Sample of Hemophilia Patients’ Family Structures: A... by Maricela Osorio-Guzmán, Silvina Graña

“…Abstract: Chronic diseases such as hemophilia go beyond the containment of institutional health care systems and involve not only a patient’s personal daily life but also their social networks. …”
Get full text

Tumor Microenvironment Responsive Key Nanomicelles for Effective Against Invasion and Metastasis in Ovarian Cancer Using Mice Model by Liu Y, Kong L, Yu Y, Zang J, Zhang L, Guo RB, Li ST, Cheng L, Li XT, Chen YQ

“…Nano-particles, as a novel drug delivery system, have significant potential for improving therapeutic efficacy and overcoming these challenges.Methods: According to the high expression level of matrix metalloproteinase-2 (MMP-2) in the tumor microenvironment, MMP-2 responsive nano-particles (PVGLIG-MTX-D/T-NMs) containing docetaxel and triptolide were prepared by the thin-film dispersion method. …”
Get full text

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Get full text

Burden of Anemia among Human Immunodeficiency Virus-Positive Adults on Highly Active Antiretroviral Therapy at Hawassa University Compressive Specialized Hospital, Hawassa, Ethiopi... by Sisay Tesfaye, Melaku Hirigo, Dawit Jember, Mekdes Shifeta, Worku Ketema

“…Female sex (AOR: 2.576, 95% (CI: 1.295–5.127)), having tuberculosis (TB) (AOR: 4.873, 95% (CI: 1.534–15.484)), taking a zidovudine (ZDV)-containing ART regimen (AOR: 5.216, 95% (CI: 1.239–21.962)), having clinical WHO stage IV and III diseases (AOR: 3.077, 95% CI (1.244–7.612)), having body mass index (BMI) <18.5 kg/m2 (AOR: 2.391, 95% (CI: 1.138–5.023)), and taking cotrimoxazole prophylaxis (AOR: 3.860 95% (CI: 1.097–13.576)) were substantially linked to the development of anemia among adult HIV patients. …”
Get full text

Effects of ruminal short-chain fatty acid concentration and pH on histology, hematology, and inflammation in cannulated Holstein dairy calves by A.R. Wolfe, M.H.P.M. Narciso, R.R.E. Uwiera, A.H. Laarman

“…On wk 3, 5, and 7, calves underwent a 4-h reticulorumen wash procedure with a physiological buffer containing the various treatments. Blood samples were collected weekly after feeding. …”
Get full text

The Effect of Cumin on the Formation of <i>β</i>-Carboline Heterocyclic Amines in Smoked Meat and Simulated Systems by Xiuxiu Liu, Wenyu Chen, Minghao Sun, Xufang Lv, Xing Shen, Zhongping Chai, Maomao Zeng

“…To further validate the practical application potential of these extracts, we prepared meat patty samples containing different concentrations of cumin powder, simulating actual processing conditions. …”
Get full text

SDG11-Based Sustainability Assessment of Urban Communities: A Case Study of Changsha by Qin Shuqian, Zhang Nan, Zhu Peijuan, Zhang Yong, Zhang Chen

“…Based on the "economy-society-environment" three-dimensional theoretical framework for sustainable development, this study deconstructs the connotation of SDG11 at the community level, and constructs an urban community sustainability assessment indicator system containing 7 goals and 13 indexes. In addition, by taking 602 sample communities in the built-up regions of Changsha as an example, this study utilizes multi-source big data to comprehensively assess community sustainability as well as the coupling coordination degree of the communities' economic-social-environmental systems. …”
Get full text

Evaluation of different sesame varieties cultivated under saline conditions in the southwestern coastal region of Bangladesh by Md Shihab Uddine Khan, Md Moshiur Rahman, Arup Ratan Basak, Prodipto Bishnu Angon, Sadia Afroz Ritu, Milon Kobir, Md Riazul Islam

“…The salty portions of the country have much lower agricultural yields, cropping intensities, and productivity than the rest of the country. …”
Get full text

Burden of Mental Morbidities among Health Care Workers in a Tertiary Care Hospital Of West Bengal during Third Wave of COVID-19 Pandemic: A Cross-Sectional Study by Soumi Ghosh, Sourav Bag, Arijit Mondal, Soumit Roy

“…A cross-sectional rapid survey was conducted using an online questionnaire containing the Beck Anxiety Inventory (BAI) and Beck Depression Inventory-II (BDI-II) among HCWs in the hospital using a Google Proforma through various social media groups. …”
Get full text

Evaluation of a new human immunodeficiency virus antigen and antibody test using light-initiated chemiluminescent assay by Yijun Li, Fangfang Jin, Yunhui Li, Yan Li, Yajie Wang, Ximing Yang

“…Using national reference panels and banked sample pools, LiCA® successfully detected all negative and positive controls in line with the criteria, and all HIV-positive specimens containing different viral subtypes. In 13 seroconversion panels, LiCA® detected reactive results on average 5.73 days (95% CI: 3.42–8.04) after the initial RNA test results were confirmed positive, which was 1.27 days earlier (−3.75 to 1.21) compared to Architect®. …”
Get full text