Activated Growth Factor From Platelets as Treatment for Diabetic Retinopathy Through Antioxidant-Oxidative Stress Pathway by Amin R, Hidayat R, Maritska Z, Putri TW

“…The retinal tissue of diabetic rats showed a decline in antioxidant activity due to oxidative stress. AGF containing TGF-β (10 ng/mL and 100 ng/mL) significantly increased SOD activity (p< 0.05). …”
Get full text

Carbon dioxide net assimilation exchange in a young pecan nut orchard during the growth cycle by A. Zermeño-Gonzalez, E.A. Jimenez-Alcala, J.A. Gil-Marin, H. Ramirez-Rodriguez, M. Cadena-Zapata, A.I. Melendres-Alvarez

“…This study aimed to determine the carbon dioxide net ecosystem exchange of an orchard of young pecan nut trees in northern Mexico, and its relationship with the growth months of the trees.METHODS: The study was carried out from March to November 2017 in a six-year-old pecan nut tree orchard containing trees of the Western Schley and Wichita varieties. …”
Get full text

Gedunin Mitigates <i>Cutibacterium acnes</i>-Induced Skin Inflammation by Inhibiting the NF-κB Pathway by Ju Kyoung Sim, Ye Ji Heo, Jin Hak Shin, Seon Sook Kim, Su Ryeon Seo

“…Mechanistic studies focused on the nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways, along with the NOD-like receptor pyrin domain-containing 3 (NLRP3) inflammasome. An in vivo acne model was employed to examine gedunin’s therapeutic efficacy. …”
Get full text

THE USE OF ZIRCONIUM CEMENTS IN MEDICINE: PHYSICO-CHEMICAL PROPERTIES AND CLINICAL BENEFITS by Giuroiu Cristian Levente, Clara Haddad, Cristina Albert, Doina Spaiuc, Rusnac Roman, Cezarina Dragomirescu, Alexandru Patrascu, Alina Stefanache

“…Aim of the Study: Zirconium-containing cements are now an important material in restorative dentistry, providing improved mechanical properties, biocompatibility, and aesthetics, leading to their growing usage in dental practices. …”
Get full text

The members of zinc finger-homeodomain (ZF-HD) transcription factors are associated with abiotic stresses in soybean: insights from genomics and expression analysis by Hafiz Muhammad Rizwan, Jiayi He, Muhammad Nawaz, Keyu Lu, Mingfu Wang

“…Results In this study, 51 ZF-HD genes were identified in the soybean genome that were unevenly distributed on 17 chromosomes. All GmZF-HD genes contained a conserved ZF-HD_dimer domain and had diverse physicochemical features. …”
Get full text

Assessing validity and reliability of the Transition Shock Scale for Undergraduate Nursing Students (TSS, Chinese version) in associate degree nursing students by Huiting Weng, Ziwei Ding, Li Yang, Bo Zhang, Yuanyuan Luo, Qin Wang

“…The TSS is a tool used in various countries and has been translated into Chinese; however, associate degree nurses dominate China’s nursing workforce, it needs to be validated in associate degree nursing interns. …”
Get full text

Analysis of the mechanism of Zangjiangzhi capsule in the treatment of hyperlipidemia based on its ingredients identified by UHPLC-Q-Exactive-Orbitrap-MS by Changting He, Yuling Zhao, Yongchun Huang, Yudong Su, Shoude Zhang

“…Conclusions: This study showed that ZJZC contains various active ingredients and can modulate multiple targets and pathways associated with HLP, providing evidence at the molecular level for its clinical application in the treatment of HLP.…”
Get full text

From the Banks of the Orkhon to the Banks of the Neva: the History of Mining and Transit of Mongolian Gold to the Russian Empire at the beginning of the 20th century. by Aldar A. Shirapov, Anna M. Plekhanova

“…The strengthening of the ruble exchange rate and its free conversion provided the country with an influx of foreign investment, which contributed to the constant growth of its economy. …”
Get full text

The Gesangleiter in Joseph Riepel’s Baßschlüssel (1786) – First Part by Stefan Eckert

“…While the original manuscript upon which the edited version is based does not seem to have survived, a manuscript copy held in the British Library (GB-Lbl Add. 31034) contains at least twelve pages in dialogue form that are related to the Baßschlüssel, but that are not part of the published chapter. …”
Get full text

CH4-C3H8 mixed gas hydrates formation in marine mud and foraminifera-rich sand from the South China Sea: an experimental approach by Peixiao Mao, Peixiao Mao, Peixiao Mao, Judith M. Schicks, Mengdi Pan, Mengdi Pan, Nengyou Wu, Nengyou Wu

“…Gas hydrates were formed from water and a constant-feed gas composition containing 96 mol% CH4 and 4 mol% C3H8. The formation process was continuously observed using microscopic observation and in situ Raman spectroscopy. …”
Get full text

Low body mass index as a predictor of sputum culture conversion and treatment outcomes among patients receiving treatment for multidrug-resistant tuberculosis in Lesotho by Lawrence Oyewusi, Chengbo Zeng, KJ Seung, Stephanie Mpinda, Mikanda Kunda, Carole D Mitnick, Makelele Kanu, Meseret Tamirat, Joalane Makaka, Mabatloung Mofolo, Refiloe Maime, Llang Maama, Ninza Senyo, Bamidele Oguntoyinbo, Lwayi Mayombo, Molly F Franke

“…Methods Secondary data from a prospective cohort of patients initiating a longer (18–20 months) treatment containing bedaquiline and/or delamanid under routine programmatic conditions in Lesotho were analysed. …”
Get full text

FEAR OF SOCIAL ALIENATION OF LOVE AS GENDER CHARACTERISTICS by V. V. Melnyk, L. І. Моzhovyi, I. A. Reshetova

“…The range of problem in a single topic is in the "point I", surrounded by gender boundaries, it contains as a condition for its manifestation the personality distancing – free (self) or forced (isolation) consolidation and assertion of the autonomy of the individual. …”
Get full text

Bacterial Profile and Antibiotic Susceptibility Pattern of Urinary Tract Infection among Pregnant Women Attending Antenatal Care at a Tertiary Care Hospital in Southern Ethiopia by Ashenafi Tula, Abraham Mikru, Tsegaye Alemayehu, Beyene Dobo

“…Midstream urine was collected from pregnant women using sterile containers. Culture and sensitivity were performed using a standard operating procedure of the microbiology laboratory. …”
Get full text

Nitrification and denitrification in pond by Yuni Puji Pujihastuti

“…Five process of nitrogen biogeochemical cycle in the container cultivation is the amonification, nitrification, nitrogen assimilation, denitrification and nitrogen fixation. …”
Get full text

Effects of Probiotic Bacillus sp. on Food Convertion and Growth of Catfish Pangasius hypophthalmus by Dedi Jusadi, E. Gandara, Ing Mokoginta

“…Prior the feeding, probiotic (contained Bacillus sp. 4,2x106 CFU.ml-1) were added into the diet at a dosage of 0, 5, 15 or 25 ml.kg-1 diet. …”
Get full text

Biomass and Yield in Solanum lycopersicum Expressing a Synthetic Photorespiration Pathway by Laura Dougherty, Bret Cooper, James Bunce, Bryan Vinyard, John Stommel

“…The tomato cultivar Moneymaker was transformed with a synthetic photorespiration pathway construct containing a Cucurbita maxima malate synthase (MS) gene and a Chlamydomonas reinhardtii glycolate dehydrogenase (CrGDH) gene targeted to the chloroplast, with a plastid glycolate-glycerate translocator 1 (PLGG1) hairpin interference construct targeting the native photorespiratory pathway. …”
Get full text

Could Infectious Agents Play a Role in the Onset of Age-related Macular Degeneration? A Scoping Review by Petra P. Larsen, MD, PhD, Virginie Dinet, PhD, Cécile Delcourt, PhD, Catherine Helmer, MD, PhD, Morgane Linard, MD, PhD

“…Clinical relevance: Age-related macular degeneration is a multifactorial disease and the leading cause of vision loss among older adults in developed countries. Clarifying whether certain infections participate in its onset or progression seems essential, given the potential implications for treatment and prevention. …”
Get full text

Analisis Metode Estimasi Biaya pada Perangkat Lunak Beserta Faktor-Faktor yang Mempengaruhi : A Systematic Literature Review by Amelia Devi Putri Ariyanto, Lutfiyatul ‘Azizah, Umi Laili Yuhana

“…The purpose of this study is to create a Systematic Literature Review (SLR) which contains a summary and analysis of the latest research developments on cost estimation in software, especially in the methods used and the factors that affect cost estimation. …”
Get full text

Descripción de la estructura familiar de una muestra de pacientes con hemofilia. Comparación Argentina-México / Description of a Sample of Hemophilia Patients’ Family Structures: A... by Maricela Osorio-Guzmán, Silvina Graña

“…Abstract: Chronic diseases such as hemophilia go beyond the containment of institutional health care systems and involve not only a patient’s personal daily life but also their social networks. …”
Get full text

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of &#x003E; 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Get full text