Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Get full text

Effects of Dietary Addition of a Low-Pectin Apple Fibre Preparation on Rats by Fotschki Bartosz, Jurgoński Adam, Juśkiewicz Jerzy, Kołodziejczyk Krzysztof, Sójka Michał

“…The nutritional experiment was performed on rats allocated to 2 groups of 10 animals each and fed for 2 weeks with either a control cellulose-containing diet or an experimental low-pectin apple fibre-containing diet. …”
Get full text

Cobalamin Malabsorption due to a Dysfunctional Intrinsic Factor by Jeanne Drouin, Nadia Mikhael

“…An 18-year-old French Canadian student presenting with a severe normocytic anemia, had undetectable serum cobalamin but normal gastric acidity and no evidence of generalized malabsorption. The gastric juice contained a normal quantity of intrinsic factor. Serum anti-intrinsic factor blocking antibodies were not present. …”
Get full text

Phenolic Profile, Sugar Composition, and Antioxidant Capacities of Some Common Date Palm (Phoenix dactylifera L.) Cultivars as a Potential Nutraceutical and Functional Food Ingredi... by Imen Bettaieb, Ahlem Kilani, Khadija Ben Othman, Mohamed Ali Benabderrahim, Walid Elfalleh

“…Contrary to the Deglet Nour variety, the six common dates contain a high amount of fructose and glucose (reducing sugars) and a low content of sucrose. …”
Get full text

Differences in Nanoplastic Formation Behavior Between High-Density Polyethylene and Low-Density Polyethylene by Hisayuki Nakatani, Teruyuki Yamaguchi, Mika Asano, Suguru Motokucho, Anh Thi Ngoc Dao, Hee-Jin Kim, Mitsuharu Yagi, Yusaku Kyozuka

“…LDPE was synthesized by radical polymerization, so it contained a cross-linked part. The part was not sufficiently fused, and when it degraded, it delaminated and separated preferentially. …”
Get full text

A Clinical Data Analysis Based Diagnostic Systems for Heart Disease Prediction Using Ensemble Method by Ankit Kumar, Kamred Udham Singh, Manish Kumar

“…To get the best results, the dataset contains certain unnecessary features that are dealt with using isolation logistic regression and Support Vector Machine (SVM) classification.…”
Get full text

A comparative analysis of information sources about the prevalence of congenital anomalies of Lithuanian children by Jurgita Židanavičiūtė, Marijus Radavičius, Jurgis Sušinskas, Algirdas Utkus

“… The work is based on data from two data bases containing information about the prevalence of congenital anomalies of Lithuanian children. …”
Get full text

Les conséquences politiques de la traduction néomanagériale de la compensation : l’impensé systémique by Rémy Petitimbert, Clémence Guimont

“…In a context of biodiversity crisis, we should emphasize the shifting between biodiversity offsetting tool (in order to contain biodiversity crisis) and their irreversible ecological consequences.…”
Get full text

Effects of the Salt-Processing Method on the Pharmacokinetics and Tissue Distribution of Orally Administered Morinda officinalis How. Extract by Ji Shi, Xiaohang Ren, Jia Wang, Xiaofeng Wei, Bonan Liu, Tianzhu Jia

“…Formic acid aqueous solution (0.1%; A) and acetonitrile (containing 0.1% formic acid; B) were used as the mobile phase system with a programmed elution of 0∼5 min with 70% A and then 5∼7 min with 60% A. …”
Get full text

Pengaruh Hormon Androgen terhadap Ekspresi Gen CD52 di Epididimis Mencit (Mus musculus) by Silvani Permatasari, Dwi Ari Pujianto, Astrid Teresa

“…And then quantitative real-time RT-PCR was used to analyse expression of CD52 and it’s normalized to Beta actin. Result: CD52 contained a two potential phosphorylation sites for protein kinase C and casein kinase II, N-myristoylation, and N-glycosylation that showed CD52 is secretory protein and predict it’s attached to sperm membrane. …”
Get full text

Current Strategies to Generate Human Mesenchymal Stem Cells In Vitro by Jennifer Steens, Diana Klein

“…However, the proportion of MSCs contained in primary isolates of adult tissue biopsies is rather low and, thus, vigorous ex vivo expansion is needed especially for therapies that may require extensive and repetitive cell substitution. …”
Get full text

Dynamics of socially oriented non-profit organizations development as providers of socially important services in the regions of the Northwestern Federal District of the Russian Fe... by A. S. Artamonova

“…The assessment of the SONPOs development rates for all types of socially important services contained in the official statistical information has shown that, while their number is practically unchanged, the increase in the financial support volume leads to an increase in their consumers’ number. …”
Get full text

Numerical study of enhanced nanofluid heat transfer in an open cavity with heated obstacles using LBM by Makaoui Abdelilah, Lahmer El Bachir, Benhamou Jaouad, Moussaoui Mohammed Amine, Mezrhab Ahmed

“…This paper employs the lattice Boltzmann method to investigate the heat transfer properties of a nanofluid circulating within an open square cavity that contains three heated obstacles. The nanofluid is introduced into the system via a lower inlet and exits the system via an outlet located at the top of the opposite wall, flowing along the cavity walls. …”
Get full text

Absent in melanoma 2: a potent suppressor of retinal pigment epithelial-mesenchymal transition and experimental proliferative vitreoretinopathy by Yu Chen, Mingyuan Jiang, Liping Li, Shanshan Yang, Zuimeng Liu, Shiwen Lin, Wanxiao Wang, Jinyang Li, Feng Chen, Qiang Hou, Xiaoyin Ma, Ling Hou

“…Moreover, treatment with eye drops containing an AKT inhibitor alleviated RPE-EMT and the severity of experimental PVR. …”
Get full text

In silico analysis of ventricular action potential with a current–voltage‐time representation: Thresholds, membrane resistance, repolarization reserve by Massimiliano Zaniboni

“…Abstract The waveform of ventricular action potential (AP) is a key determinant of the cardiac cycle, a marker of beating pathophysiology, and a target for anti‐arrhythmic drug design. The information contained in the waveform, though, is limited to the actual dynamics of the AP under consideration. …”
Get full text

Azurin a potent anticancer and antimicrobial agent isolated from a novel Pseudomonas aeruginosa strain by Nourhan A. Zaghloul, Mona K. Gouda, Yasser Elbahloul, Nancy M. El Halfawy

“…The results of NMR revealed the presence of characteristic amino acids such as methionine and cysteine, which confirmed the EDX results for sulfur-containing amino acids. Purified azurin exhibited antimicrobial activity against Staphylococcus aureus, Bacillus subtilis, Escherichia coli, and Klebsiella pneumoniae. …”
Get full text

Innovative Application of Biopolymer Keratin as a Filler of Synthetic Acrylonitrile-Butadiene Rubber NBR by Mirosława Prochoń, Anita Przepiórkowska

“…In that aerobic environment, microorganisms, bacteria, and fungus digested better polymer materials containing natural additives.…”
Get full text

Tripled Coincidence Point Theorems for Nonlinear Contractions in Partially Ordered Metric Spaces by Binayak S. Choudhury, Erdal Karapınar, Amaresh Kundu

“…The example shows that the extension proved here is actual and also the main theorem properly contains all its corollaries.…”
Get full text

Save a Child: Know How to Identify and Report Child Abuse by Andrew E. Toelle, Kate Fogarty

“…Toelle and Kate Fogarty, discusses child abuse laws and procedures for reporting abuse. It also contains information about different types of abuse and how to identify abused or neglected children. …”
Get full text

APPLICATION OF NORMS ON THE ENCOURAGEMENT OF PUBLIC CIVIL SERVANTS AS A BASIS FOR PUBLIC EXPENSES by Victoria V. Volkova

“…In addition, they also contain measures aimed at optimizing expenditures and increasing the transparency of the incentive process. …”
Get full text