iPSC-derived exosomes as amphotericin B carriers: a promising approach to combat cryptococcal meningitis by Jingyu Zhao, Jingyu Zhao, Wei Fang, Yangjie Gao, Jiquan Chen, Guizhen Wang, Julin Gu

Get full text

Decoding MexB efflux pump genes: structural, molecular, and phylogenetic analysis of multidrug-resistant and extensively drug-resistant Pseudomonas aeruginosa by Muhammad Bilal Habib, Naseer Ali Shah, Afreenish Amir, Huda Ahmed Alghamdi, Muhammad Haseeb Tariq, Kiran Nisa, Mariam Ammoun

“…The current investigation aims to detect MexB genes in P. aeruginosa, their structural and molecular analysis and their impact on antimicrobial susceptibility profiling.MethodsA total of 42 clinical specimens were aseptically collected from hospitalized patients who had underlying infections related to medical implants. Matrix-assisted laser desorption ionization-time of flight (MALDI-ToF) were used for the identification of isolates. …”
Get full text

Azithromycin in the Management of Upper Respiratory Tract Infections (URTIs): Indian Real-Life Experience by Dominic M, Srivastava R, Shah K, Naik SM, Rout K, Ray B, Patil D, Rana D, Swami OC

“…Mathew Dominic,1 Rakesh Srivastava,2 Kshitij Shah,3 Sudhir M Naik,4 Khageswar Rout,5 Bidhan Ray,6 Dinesh Patil,7 Darshan Rana,7 Onkar C Swami7 1Medical Trust Hospital, Ernakulam, 682016, Kerala, India; 2Raj ENT Centre and Voice Clinic, Lucknow, 226010, Uttar Pradesh, India; 3Criticare Asia Hospital, Mumbai, 400028, Maharashtra, India; 4The Oxford Medical College and Research Hospital, Bangalore, 562107, Karnataka, India; 5LASER ENT Clinic, Bhubaneswar, 751021, Orissa, India; 6IIMSAR & Dr. …”
Get full text

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Get full text

Functional outcomes in early (T1/T2) supraglottic cancer: a systematic review by Benjamin van der Woerd, Krupal B. Patel, Anthony C. Nichols, Kevin Fung, John Yoo, S. Danielle MacNeil

“…Studies were included if they reported functional outcomes on 10 or more patients with early stage SGC treated with radiation or OPS, including open partial laryngectomy, transoral laser microsurgery (TLM) or transoral robotic surgery (TORS). …”
Get full text

A New Nanocomposite for Inducing Demineralized Dentin Remineralization by Ban G, Long J, Yan K, Li Q, Huang X, Wei X, Xie F

“…The effects were observed using a laser scanning confocal fluorescence microscope (CLSM), scanning electron microscopy (SEM), and TEM.Results: The PAMAM-COOH/ACMP-MDP ethanol solution we prepared maintained stable physicochemical properties after two months of storage. …”
Get full text

Micro-Electro Nanofibrous Dressings Based on PVDF-AgNPs as Wound Healing Materials to Promote Healing in Active Areas by Liu T, Xie F, Geng L, He R, Sun M, Ni T, Xu P, Xing C, Peng Y, Chen K, Fang Y

“…Tiantian Liu,1,2,* Feifei Xie,3,4,* Lele Geng,1,2 Ruizhe He,1,2 Mengzhe Sun,1,2 Tao Ni,1,2 Peng Xu,1,2 Chao Xing,1,2 Yinbo Peng,1,2 Ke Chen,3,4 Yong Fang1,2 1Department of Burns and Plastic Surgery, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China; 2Institute of Traumatic Medicine, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China; 3School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai, People’s Republic of China; 4Shanghai Key Laboratory of Materials Laser Processing and Modification, Shanghai Jiao Tong University, Shanghai, People’s Republic of China*These authors contributed equally to this workCorrespondence: Yong Fang, Department of Burns and Plastic Surgery, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China, Email fangyong1020@hotmail.com Ke Chen, School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai, People’s Republic of China, Email chenke83@sjtu.edu.cnPurpose: The purpose of this study is to develop an innovative solution for chronic wounds in high-mobility areas, such as joints, where conventional treatments are hindered by passive healing mechanisms and the need for immobilization. …”
Get full text

Molecular Epidemiological Characteristics of <i>Staphylococcus pseudintermedius</i>, <i>Staphylococcus coagulans,</i> and Coagulase-Negative Staphylococci Cultured from Clinical Ca... by Sara Horsman, Julian Zaugg, Erika Meler, Deirdre Mikkelsen, Ricardo J. Soares Magalhães, Justine S. Gibson

“…These isolates underwent matrix-assisted laser desorption ionisation– time of flight bacterial identification, minimum inhibitory concentration testing using Sensititre^TM plates and WGS. …”
Get full text

Evaluation of the impact of acidic medications and fluoride-containing mouthwash on the enamel surface using quantitative light-induced fluorescence, microhardness, and scanning el... by Saanya Bhasin, Simran Singh, Manuel Sebastian Thomas, Karuna Yarmunja Mahabala, Ramya Shenoy

“…Forty-eight samples were tested for surface demineralization via quantitative laser fluorescence (QLF), and the other forty-eight samples were tested for enamel microhardness via a Vickers hardness tester. …”
Get full text

The Effect of A2E on the Ca2+-PKC Signaling Pathway in Human RPE Cells Exposed to Blue Light by Maomei Luo, Shu Wang, Yun Tang, Chun Zeng, Shanjun Cai

“…Fluo-3/AM staining was used to determine the level of cytoplasmic Ca2+, and the cells were photographed using a laser scanning confocal microscope to analyze the fluorescence intensity. …”
Get full text

The Effect of A2E on the Uptake and Release of Calcium in the Lysosomes and Mitochondria of Human RPE Cells Exposed to Blue Light by Mao-Mei Luo, Lin Chen, Shu Wang, Chun Zeng, De-Zhi Li, YeGe Bi, Long-Qian Liu, Shan-Jun Cai

“…In order to measure the calcium levels in the different organelles, RPE were imaged using a laser scanning confocal microscope. Moreover, changes in the mitochondrial membrane potential were detected by flow cytometry analysis of JC-1-stained cells. …”
Get full text

Transcriptome Analysis of Effect of Cordyceps militaris Aqueous Extract in Human Gastric Cancer Cell BGC-823 on Different RCD Pathways by Mingqi CUI, Kaiwen YU, Yang SONG, Fangxu XU, Shenghou WANG, Ze WANG

“…Transcriptome analysis revealed significant differentially expressed genes (DEGs) and their Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment, resulting in the identification of 10 hub genes involved in the apoptosis, autophagy, necroptosis, and ferroptosis signaling pathways. Laser confocal microscopy, flow cytometry, and quantitative real time polymerase chain reaction (qRT-PCR) were employed to further validate the induction of apoptosis in gastric cancer cells by the XG aqueous extract. …”
Get full text

The Impact of Optical Undersampling on the Ca2+ Signal Resolution in Ca2+ Imaging of Spontaneous Neuronal Activity by Katarina D. Milicevic, Violetta O. Ivanova, Tina N. Brazil, Cesar A. Varillas, Yan M.D. Zhu, Pavle R. Andjus, Srdjan D. Antic

Get full text

New Circumpapillary Retinal Nerve Fiber Layer Thickness and Bruch’s Membrane Opening-Minimum Rim Width Assessment in Nonglaucomatous Eyes with Large Discs by Serife Bayraktar, Gulnar Sultanova, Zafer Cebeci, Emre Altinkurt, Belgin Izgi

“…The optic nerve head (ONH) parameters obtained by confocal scanning laser ophthalmoscopy (CSLO), peripapillary RNFL thickness, BMO area, and BMO-MRW were imaged with SD-OCT. …”
Get full text

Distribution and Antifungal Susceptibility Profile of Oropharyngeal Candida Species Isolated from People Living with HIV in the Era of Universal Test and Treat Policy in Uganda. by Musinguzi, Benson, Turyamuhika, Laban, Mwesigwa, Alex, Nalumaga, Pauline Petra, Kabajulizi, Immaculate, Njovu, Israel Kiiza, Mwebesa, Edson, Luggya, Tonny, Ocheng, Francis, Kateete, David Patrick, Itabangi, Herbert, Mboowa, Gerald, Obondo, James Sande, Achan, Beatrice

“…Oropharyngeal swabs were collected and cultured on Sabouraud Dextrose agar to isolate Candida species identified using the matrix-assisted laser desorption ionization-time of flight mass spectrometry. …”
Get full text

Assessment of photoreceptor recovery and visual function utilizing adaptive optics and microperimetry in patients with surgically closed macular holes by Yuanyuan Liu, Xueli Yang, Wei Zhou, Jinguo Yu, Song Chen, Tiangeng He, Caiyun You, Xiangda Meng, Mengyu Liao, Yi Lei, Hua Yan

“…Using adaptive optics scanning laser ophthalmoscopy (AOSLO) and microperimetry, we aimed to provide a more detailed understanding of photoreceptor recovery and visual improvement in closed MHs. …”
Get full text

Hybridization-based discovery of novel quinazoline-2-indolinone derivatives as potent and selective PI3Kα inhibitors by Changqun Liu, Yuening Cao, Yi Zuo, Chaozheng Zhang, Senmiao Ren, Xin Zhang, Chuanqi Wang, Yingjie Zeng, Jie Ling, Yilan Liu, Zixian Chen, Xiujun Cao, Zhengzhi Wu, Chuantao Zhang, Jun Lu

“…The biological evaluation of compound 8 was performed by transwell, flow cytometry, laser scanning confocal microscopy, Western blot, CTESA and immunohistochemistry. …”
Get full text

Earth–lunar thermal effect on the temperature stability of TianQin telescope and the suppression methods by Wenbo Chang, Yuxiang Wang, Wenhai Tan, Guanhua Wu, Houyuan Chen, Wei Li, Zizheng Li, Fan Zhu, Zhu Li, Xuefeng Zhang, Shanqing Yang

“…A bunched entrance baffle is optimized by Linear Programming analysis based on the smallest laser aperture and baffle geometric size constraint and then achieved temperature stability of about 0.3 mK/Hz @0.1 mHz for the secondary mirror. …”
Get full text

Microscale bone interlocking enhances osseointegration strength on the rough surface of 3D-printed titanium implants: experimental and finite element analysis by Tianyu Shu, Haoyu Shi, Meng Li, Yu-Chia Lin, Ang Li, Dandan Pei

“…Methods Experimental 3D-printed titanium implants were fabricated via selective laser melting (SLM), and conventional sandblasted and acid-etched titanium implants (CNC-SLA) served as the control group. …”
Get full text

Merck Open Global Health Library in vitro screening against Schistosoma mansoni identified two new substances with antischistosomal activities for further development by Monique Evelyn Ueberall, Martina Berchthold, Cécile Häberli, Sven Lindemann, Thomas Spangenberg, Jennifer Keiser, Christoph G. Grevelding

“…The effects of the two lead structures were investigated in more detail by confocal laser scanning microscopy and 5-ethynyl 2´-deoxyuridine (EdU) assays to assess morphological effects and stem cell effects. …”
Get full text