Decoding MexB efflux pump genes: structural, molecular, and phylogenetic analysis of multidrug-resistant and extensively drug-resistant Pseudomonas aeruginosa by Muhammad Bilal Habib, Naseer Ali Shah, Afreenish Amir, Huda Ahmed Alghamdi, Muhammad Haseeb Tariq, Kiran Nisa, Mariam Ammoun

“…The current investigation aims to detect MexB genes in P. aeruginosa, their structural and molecular analysis and their impact on antimicrobial susceptibility profiling.MethodsA total of 42 clinical specimens were aseptically collected from hospitalized patients who had underlying infections related to medical implants. Matrix-assisted laser desorption ionization-time of flight (MALDI-ToF) were used for the identification of isolates. …”
Get full text

A flexible catheter-based sensor array for upper airway soft tissues pressure monitoring by Jiang Shang, Xiaoxiao Ma, Peikai Zou, Chenxiao Huang, Zhechen Lao, Junhan Wang, Tingshu Jiang, Yanzhe Fu, Jiebo Li, Shaoxing Zhang, Ruya Li, Yubo Fan

“…The sensor’s design and versatile 3D femtosecond laser fabrication process enable adaptation to diverse materials and applications. …”
Get full text

Azithromycin in the Management of Upper Respiratory Tract Infections (URTIs): Indian Real-Life Experience by Dominic M, Srivastava R, Shah K, Naik SM, Rout K, Ray B, Patil D, Rana D, Swami OC

“…Mathew Dominic,1 Rakesh Srivastava,2 Kshitij Shah,3 Sudhir M Naik,4 Khageswar Rout,5 Bidhan Ray,6 Dinesh Patil,7 Darshan Rana,7 Onkar C Swami7 1Medical Trust Hospital, Ernakulam, 682016, Kerala, India; 2Raj ENT Centre and Voice Clinic, Lucknow, 226010, Uttar Pradesh, India; 3Criticare Asia Hospital, Mumbai, 400028, Maharashtra, India; 4The Oxford Medical College and Research Hospital, Bangalore, 562107, Karnataka, India; 5LASER ENT Clinic, Bhubaneswar, 751021, Orissa, India; 6IIMSAR & Dr. …”
Get full text

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Get full text

Polydomus karssenii gen. nov. sp. nov. is a dark septate endophyte with a bifunctional lifestyle parasitising eggs of plant parasitic cyst nematodes (Heterodera spp.) by Samad Ashrafi, Jan-Peer Wennrich, Yvonne Becker, Jose G. Maciá-Vicente, Anke Brißke-Rode, Matthias Daub, Torsten Thünen, Abdelfattah A. Dababat, Maria R. Finckh, Marc Stadler, Wolfgang Maier

“…Light microscopic observations on fungus-root interactions in an axenic system revealed the capacity of the same fungal strain to colonise the roots of wheat and produce melanised hyphae and microsclerotia-like structure typical for dark septate endophytes. Confocal laser scanning microscopy further demonstrated that the fungus colonised the root cells by predominant intercellular growth of hyphae, and frequent formation of appressorium-like as well as penetration peg-like structures through internal cell walls surrounded by callosic papilla-like structures. …”
Get full text

Evolution of a seafloor massive sulfide deposit on axial volcanic ridges: a case study of the Duanqiao hydrothermal field, Southwest Indian Ridge by Weifang Yang, Chunhui Tao, Chunhui Tao, Shili Liao, Huichao Zhang, Huichao Zhang, Chuanwei Zhu, Wei Li, Guoyin Zhang, Xuefeng Wang, Lisheng Wang

“…In this study, we conducted mineral texture, geochemical, 230Th/U dating, and laser ablation inductively coupled plasma mass spectrometer analyses of a drill core containing shallow sulfide deposits to study their evolution process. …”
Get full text

Anthelmintic Activity of Crude Extract and Essential Oil of Tanacetum vulgare (Asteraceae) against Adult Worms of Schistosoma mansoni by Loyana Silva Godinho, Lara Soares Aleixo de Carvalho, Clarissa Campos Barbosa de Castro, Mirna Meana Dias, Priscila de Faria Pinto, Antônio Eduardo Miller Crotti, Pedro Luiz Silva Pinto, Josué de Moraes, Ademar A. Da Silva Filho

“…TV (200 μg/mL) was also able to reduce viability and decrease production of developed eggs. Confocal laser scanning microscopy showed morphological alterations in the tegument of the S. mansoni surface after incubation with TV (50 and 100 μg/mL). …”
Get full text

The Small Mobile Ozone Lidar (SMOL): instrument description and first results by F. Chouza, T. Leblanc, P. Wang, S. S. Brown, K. Zuraski, K. Zuraski, W. Chace, W. Chace, W. Chace, C. C. Womack, C. C. Womack, J. Peischl, J. Peischl, J. Hair, T. Shingler, J. Sullivan

“…The transmitter is based on a quadrupled Nd:YAG laser, which is further converted into a 289/299 nm wavelength pair using Raman shifting cells, and the receiver consists of three ozone DIAL pairs, including one that is 266/289 nm and two that are 289/299 nm. …”
Get full text

The effect of electroslag remelting on the cleanliness of CrNiMoWMnV ultrahigh-strength steels by Ali M., Porter D., Kömi J., Heikkinen E.P., Eissa M., El Faramawy H., Mattar T.

“…Cast ingots were forged at temperatures between 1100 and 950°C, air cooled, and their non-metallic inclusions (NMIs) were characterized using field emission scanning electron microscopy and laser scanning confocal microscopy. Thermodynamic calculations for the expected NMIs formed in the investigated steels with and without ESR were performed using FactSage 7.2 software while HSC Chemistry version 9.6.1 was used to calculate the standard Gibbs free energies (ΔG°). …”
Get full text

msiFlow: automated workflows for reproducible and scalable multimodal mass spectrometry imaging and microscopy data analysis by Philippa Spangenberg, Sebastian Bessler, Lars Widera, Jenny Bottek, Mathis Richter, Stephanie Thiebes, Devon Siemes, Sascha D. Krauß, Lukasz G. Migas, Siva Swapna Kasarla, Prasad Phapale, Jens Kleesiek, Dagmar Führer, Lars C. Moeller, Heike Heuer, Raf Van de Plas, Matthias Gunzer, Oliver Soehnlein, Jens Soltwisch, Olga Shevchuk, Klaus Dreisewerd, Daniel R. Engel

“…Abstract Multimodal imaging by matrix-assisted laser desorption ionisation mass spectrometry imaging (MALDI MSI) and microscopy holds potential for understanding pathological mechanisms by mapping molecular signatures from the tissue microenvironment to specific cell populations. …”
Get full text

Multimessenger Probes of Supermassive Black Hole Spin Evolution by Angelo Ricarte, Priyamvada Natarajan, Ramesh Narayan, Daniel C. M. Palumbo

“…We further predict spin distributions accessible via spatially resolved event horizons by the next-generation Event Horizon Telescope and Black Hole Explorer, as well as gravitational waves by the Laser Interferometer Space Antenna (LISA), each of which offers unique and distinct windows into the population of spinning BHs. …”
Get full text

Picometre-level surface control of a closed-loop, adaptive X-ray mirror with integrated real-time interferometric feedback by Ioana-Theodora Nistea, Simon G. Alcock, Andrew Foster, Vivek Badami, Riccardo Signorato, Matteo Fusco

“…We provide a technical description and experimental results of the practical development and offline testing of an innovative, closed-loop, adaptive mirror system capable of making rapid, precise and ultra-stable changes in the size and shape of reflected X-ray beams generated at synchrotron light and free-electron laser facilities. The optical surface of a piezoelectric bimorph deformable mirror is continuously monitored at 20 kHz by an array of interferometric sensors. …”
Get full text

Scientific virtual reality as a research tool in prehistoric archaeology: the case of Atxurra Cave (northern Spain) by Antonio Torres, Mª Ángeles Medina-Alcaide, Iñaki Intxaurbe, Olivia Rivero, Joseba Rios-Garaizar, Martin Arriolabengoa, Juan Francisco Ruiz-López, Diego Garate

“…The study included analysing both three-dimensional (3D) models of the cave, obtained through photogrammetry and laser scanning, and the lighting systems in the graphics engine ©Unreal Engine 5; this allowed the researchers to create an interactive VR environment that faithfully reflects the current state of scientific knowledge about the cavity. …”
Get full text

A structural analysis of ordered Cs3Sb films grown on single crystal graphene and silicon carbide substrates by C. A. Pennington, M. Gaowei, E. M. Echeverria, K. Evans-Lutterodt, A. Galdi, T. Juffmann, S. Karkare, J. Maxson, S. J. van der Molen, P. Saha, J. Smedley, W. G. Stam, R. M. Tromp

“…In this report, we demonstrate the growth of ordered Cs3Sb films on single crystal substrates 3C-SiC and graphene-coated 4H-SiC using pulsed laser deposition and conventional thermal evaporation growth techniques. …”
Get full text

Functional outcomes in early (T1/T2) supraglottic cancer: a systematic review by Benjamin van der Woerd, Krupal B. Patel, Anthony C. Nichols, Kevin Fung, John Yoo, S. Danielle MacNeil

“…Studies were included if they reported functional outcomes on 10 or more patients with early stage SGC treated with radiation or OPS, including open partial laryngectomy, transoral laser microsurgery (TLM) or transoral robotic surgery (TORS). …”
Get full text

Benzo-pyrrolidinyl substituted silicon phthalocyanines: A novel two-photon lysosomal nanoprobe for in vitro photodynamic therapy by Xiuqin Chen, Guizhi Chen, Sitong Cao, Ruoxin Ye, Ruoyi Qiu, Xiangyu Yang, Yiru Peng, Hong Sun

“…These nanoparticles exhibit exceptional lysosome labeling capabilities, as evidenced by bioimaging techniques. Upon exposure to laser irradiation, DSPE@Py-SiPc efficiently induces the production of reactive oxygen species, impairing lysosomal function and triggering lysosomal-mediated cell death. …”
Get full text

Third-Order Nonlinear Optical Behavior of Novel Polythiophene Derivatives Functionalized with Disperse Red 19 Chromophore by Marilú Chávez-Castillo, Arelis Ledesma-Juárez, Marisol Güizado-Rodríguez, Jesús Castrellón-Uribe, Gabriel Ramos-Ortiz, Mario Rodríguez, José-Luis Maldonado, Jorge-Antonio Guerrero-Álvarez, Victor Barba

“…The third-order nonlinear optical response of these materials was performed with nanosecond and femtosecond laser pulses by using the third-harmonic generation (THG) and Z-scan techniques at infrared wavelengths of 1300 and 800 nm, respectively. …”
Get full text

Quantum machine learning with Adaptive Boson Sampling via post-selection by Francesco Hoch, Eugenio Caruccio, Giovanni Rodari, Tommaso Francalanci, Alessia Suprano, Taira Giordani, Gonzalo Carvacho, Nicolò Spagnolo, Seid Koudia, Massimiliano Proietti, Carlo Liorni, Filippo Cerocchi, Riccardo Albiero, Niki Di Giano, Marco Gardina, Francesco Ceccarelli, Giacomo Corrielli, Ulysse Chabaud, Roberto Osellame, Massimiliano Dispenza, Fabio Sciarrino

“…Here, we report the experimental implementation of quantum machine learning protocols by adding adaptivity via post-selection to a Boson Sampling platform based on universal programmable photonic circuits fabricated via femtosecond laser writing. Our experimental results demonstrate that Adaptive Boson Sampling is a viable route towards dimension-enhanced quantum machine learning with linear optical devices.…”
Get full text

Electroacupuncture Involved in Motor Cortex and Hypoglossal Neural Control to Improve Voluntary Swallowing of Poststroke Dysphagia Mice by Shuai Cui, Shuqi Yao, Chunxiao Wu, Lulu Yao, Peidong Huang, Yongjun Chen, Chunzhi Tang, Nenggui Xu

“…In the present work, we have investigated the effects of EA on the PSD mice in vivo and sought evidence for PSD improvement by electrophysiology recording and laser speckle contrast imaging (LSCI). Four main conclusions can be drawn from our study: (i) EA may enhance the local field potential in noninfarction area of M1, activate the swallowing-related neurons (pyramidal cells), and increase the motor conduction of noninfarction area in voluntary swallowing; (ii) EA may improve the blood flow in both M1 on the healthy side and deglutition muscles and relieve PSD symptoms; (iii) EA could increase the motor conduction velocity (MCV) in hypoglossal nerve, enhance the EMG of mylohyoid muscle, alleviate the paralysis of swallowing muscles, release the substance P, and restore the ability to drink water; and (iv) EA can boost the functional compensation of M1 in the noninfarction side, strengthen the excitatory of hypoglossal nerve, and be involved in the voluntary swallowing neural control to improve PSD. …”
Get full text

Review on the Millimeter-Wave Generation Techniques Based on Photon Assisted for the RoF Network System by Jiangnan Xiao, Chuang Zhao, Xingxing Feng, Xu Dong, Jiangli Zuo, Jun Ming, Ye Zhou

“…Then we, respectively, introduce the modulation schemes of RoF mm-wave generation based on photon assisted including directly modulated laser (DML), external modulation, and optical heterodyne. …”
Get full text