Could Infectious Agents Play a Role in the Onset of Age-related Macular Degeneration? A Scoping Review by Petra P. Larsen, MD, PhD, Virginie Dinet, PhD, Cécile Delcourt, PhD, Catherine Helmer, MD, PhD, Morgane Linard, MD, PhD

“…Methods: Using the PubMed database, we searched for articles in English, published until June 1, 2023, whose title and/or abstract contained terms related to AMD and infections. All types of study design, infectious agents, AMD diagnostic methods, and AMD stages were considered. …”
Get full text

Scalable production of bio-calcium oxide via thermal decomposition of solid - hatchery waste in a laboratory-scale rotary kiln by Suwanan Chuakham, Ajchara I. Putkham, Yuwadee Chaiyachet, Arnusorn Saengprajak, Kriangsak Banlue, Nipon Tanpaiboonkul, Apipong Putkham

“…Moreover, the production of bio-CaO with eggshells containing eggshell membrane decreases the purity of calcium oxide by about 0.7–1.0%. …”
Get full text

Lactococcus lactis D4 Decreases NF-κB and α-SMA in Rat Models of Obstructive Jaundice by Avit Suchitra, Alvarino Alvarino, Eryati Darwin, Harnavi Harun, Muhammad Iqbal Rivai, Ade Sukma

“…The rats were maintained for 7–10 days, with the rats in BDL+LLD4 group received fermented milk containing LLD4 via gavage at a dose of 112 mg/20 gBW per day for 7 days. …”
Get full text

Analisis Metode Estimasi Biaya pada Perangkat Lunak Beserta Faktor-Faktor yang Mempengaruhi : A Systematic Literature Review by Amelia Devi Putri Ariyanto, Lutfiyatul ‘Azizah, Umi Laili Yuhana

“…The purpose of this study is to create a Systematic Literature Review (SLR) which contains a summary and analysis of the latest research developments on cost estimation in software, especially in the methods used and the factors that affect cost estimation. …”
Get full text

Inhibition of Ultraviolet B-induced Apoptosis in Fibroblasts by Human Umbilical Cord Blood Mesenchymal Stem Cell Conditioned Media via the Phosphatidylinositol-3-Kinase/Akt Pathway by Ferry Sandra, Dian Andriani Ratna Dewi, I Nyoman Mantik Astawa, Wimpie Pangkahila, Angliana Chouw, Maria Celinna, Nurrani Mustika Dewi

“…Conditioned media from human umbilical cord blood mesenchymal stem cells (CM-hUCB-MSC) contain important substances for cell regeneration. …”
Get full text

Tumor Microenvironment Responsive Key Nanomicelles for Effective Against Invasion and Metastasis in Ovarian Cancer Using Mice Model by Liu Y, Kong L, Yu Y, Zang J, Zhang L, Guo RB, Li ST, Cheng L, Li XT, Chen YQ

“…Nano-particles, as a novel drug delivery system, have significant potential for improving therapeutic efficacy and overcoming these challenges.Methods: According to the high expression level of matrix metalloproteinase-2 (MMP-2) in the tumor microenvironment, MMP-2 responsive nano-particles (PVGLIG-MTX-D/T-NMs) containing docetaxel and triptolide were prepared by the thin-film dispersion method. …”
Get full text

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Get full text

Hirudo extract ameliorates proliferative vitreoretinopathy by promoting autophagy and attenuating the THBS2/PI3K/Akt pathway by Hui Huang, Qun Huang, Jing Wang, Wanjie Wang, Yanlin Zheng

“…ARPE-19 cells were treated with several doses of Hirudo extract, that did or did not contain TGF-β2 (10 ng/mL). CCK-8, wound healing, and Transwell assays were performed to detect the viability, migration, and invasion of the cells. …”
Get full text

Burden of Anemia among Human Immunodeficiency Virus-Positive Adults on Highly Active Antiretroviral Therapy at Hawassa University Compressive Specialized Hospital, Hawassa, Ethiopi... by Sisay Tesfaye, Melaku Hirigo, Dawit Jember, Mekdes Shifeta, Worku Ketema

“…Female sex (AOR: 2.576, 95% (CI: 1.295–5.127)), having tuberculosis (TB) (AOR: 4.873, 95% (CI: 1.534–15.484)), taking a zidovudine (ZDV)-containing ART regimen (AOR: 5.216, 95% (CI: 1.239–21.962)), having clinical WHO stage IV and III diseases (AOR: 3.077, 95% CI (1.244–7.612)), having body mass index (BMI) <18.5 kg/m2 (AOR: 2.391, 95% (CI: 1.138–5.023)), and taking cotrimoxazole prophylaxis (AOR: 3.860 95% (CI: 1.097–13.576)) were substantially linked to the development of anemia among adult HIV patients. …”
Get full text

Effects of ruminal short-chain fatty acid concentration and pH on histology, hematology, and inflammation in cannulated Holstein dairy calves by A.R. Wolfe, M.H.P.M. Narciso, R.R.E. Uwiera, A.H. Laarman

“…On wk 3, 5, and 7, calves underwent a 4-h reticulorumen wash procedure with a physiological buffer containing the various treatments. Blood samples were collected weekly after feeding. …”
Get full text

The Prevalence and Risk Factors Associated with the Presence of Antibiotic Residues in Milk from Peri-Urban Dairy Cattle Farms in Kathmandu, Nepal by Erda E. Rame Hau, Minu Sharma, Bal K. Sharma Khanal, Peter D. Sly, Deirdre Mikkelsen, Nicholas Clark, Ricardo J. Soares Magalhães

“…Moreover, samples from farms with a higher number of calves and milking cows were more likely to contain single and multiple residues exceeding the MRL, while milk from farms with higher numbers of dry cows and farmers reported by a visiting chemist were less likely to have multidrug residues exceeding the MRL. …”
Get full text

The Effect of Cumin on the Formation of <i>β</i>-Carboline Heterocyclic Amines in Smoked Meat and Simulated Systems by Xiuxiu Liu, Wenyu Chen, Minghao Sun, Xufang Lv, Xing Shen, Zhongping Chai, Maomao Zeng

“…To further validate the practical application potential of these extracts, we prepared meat patty samples containing different concentrations of cumin powder, simulating actual processing conditions. …”
Get full text

SDG11-Based Sustainability Assessment of Urban Communities: A Case Study of Changsha by Qin Shuqian, Zhang Nan, Zhu Peijuan, Zhang Yong, Zhang Chen

“…Based on the "economy-society-environment" three-dimensional theoretical framework for sustainable development, this study deconstructs the connotation of SDG11 at the community level, and constructs an urban community sustainability assessment indicator system containing 7 goals and 13 indexes. In addition, by taking 602 sample communities in the built-up regions of Changsha as an example, this study utilizes multi-source big data to comprehensively assess community sustainability as well as the coupling coordination degree of the communities' economic-social-environmental systems. …”
Get full text

Evaluation of different sesame varieties cultivated under saline conditions in the southwestern coastal region of Bangladesh by Md Shihab Uddine Khan, Md Moshiur Rahman, Arup Ratan Basak, Prodipto Bishnu Angon, Sadia Afroz Ritu, Milon Kobir, Md Riazul Islam

“…Sesame (Sesamum indicum L.) is widely used in many cooking techniques worldwide, and it is known as the ''queen of oilseeds'' because it contains polyunsaturated lipids that prevent oxidative rancidity and carry oil content up to 60%. …”
Get full text

Burden of Mental Morbidities among Health Care Workers in a Tertiary Care Hospital Of West Bengal during Third Wave of COVID-19 Pandemic: A Cross-Sectional Study by Soumi Ghosh, Sourav Bag, Arijit Mondal, Soumit Roy

“…A cross-sectional rapid survey was conducted using an online questionnaire containing the Beck Anxiety Inventory (BAI) and Beck Depression Inventory-II (BDI-II) among HCWs in the hospital using a Google Proforma through various social media groups. …”
Get full text

Evaluation of a new human immunodeficiency virus antigen and antibody test using light-initiated chemiluminescent assay by Yijun Li, Fangfang Jin, Yunhui Li, Yan Li, Yajie Wang, Ximing Yang

“…Using national reference panels and banked sample pools, LiCA® successfully detected all negative and positive controls in line with the criteria, and all HIV-positive specimens containing different viral subtypes. In 13 seroconversion panels, LiCA® detected reactive results on average 5.73 days (95% CI: 3.42–8.04) after the initial RNA test results were confirmed positive, which was 1.27 days earlier (−3.75 to 1.21) compared to Architect®. …”
Get full text

The effect of different energy sources on growth performance, abdominal fat depasition and fatty liver syndrome in broilers. ii. the effect on fatty liver syndrome by Şakir Doğan TUNCER, Reşat AŞTI, Behiç COŞKUN, Hüdaverdi ERER, Mehmet Ali TEKEŞ

“…Four hundred male and 400 femal dayold Arbro 7 were randomly distributed by sex into sixteen pens with each pen containing 50 chicks.<p> In eight experimental rations, 1. …”
Get full text

Evaluation of Elemental and Chemical Compositions of Some Fuelwood Species for Energy Value by A. M. Dadile, O. A. Sotannde, B. D. Zira, M. Garba, I. Yakubu

“…Among the fuel materials used, isolated bark contained approximately 0.45% nitrogen content compared with wood without bark. …”
Get full text

The Optimum Dietary Phenylalanine Requirement of Hybrid Grouper (Epinephelusfuscoguttatus ♀ × Epinepheluslanceolatus ♂) Juveniles: Effects on Growth Performance, Gut Micromorpholog... by Pinxian Yang, Haijiao Wang, Lei Ma, Haoran Yin, Zhanying Zhu, Cong Liu, Wei Huang, Zhiyu Zhou, Xiaoyi Wu, Sehrish Taj

“…A total of seven isoenergetic (340 kcal per 100 g of dry matter), isonitrogenous, and isolipidic diets were made, containing 8.2 (Phe 8.2), 9.2 (Phe 9.2), 10.1 (Phe 10.1), 11.2 (Phe 11.2), 13.3 (Phe 13.3), 15.2 (Phe 15.2), and 17.3 g/kg (Phe 17.3), respectively. …”
Get full text

Evaluation of Chemical, Functional, Spectral, and Thermal Characteristics of Sargassum wightii and Ulva rigida from Indian Coast by Yogesh Kumar, Ayon Tarafdar, Deepak Kumar, Kiran Verma, Manjeet Aggarwal, Prarabdh C. Badgujar

“…Evaluation of mineral and CHNS content indicated that the concentration of potassium, magnesium, and calcium was 1.36 ± 0.08 mg/g, 8.39 ± 0.80 mg/g, and 14.03 ± 3.46 mg/g, respectively, that was higher in the S. wightii, whereas U. rigida contained higher value of iron, carbon, and sulphur (0.70 ± 0.13 mg/g, 37.72 ± 4.63%, and 2.61 ± 0.16%, respectively). …”
Get full text