Comparison of Serum Triglyceride and Cholesterol Levels in Premature Neonates with or without Respiratory Distress Syndrome (RDS) by Roya Kelishadi, Behzad Barekatain, Atefeh Fatahi

“…Immediately after birth and after umbilical cord clumping, blood samples were taken from the umbilical artery and triglyceride and total cholesterol levels were measured. …”
Get full text

Life threatening scorpion sting on adult complicated by: acute toxic myocarditis, cardiogenic shock, pulmonary edema, acute kidney injury and toxic hepatitis: a case report by Filmon Tesfay, Okbu Frezgi, Meron Asheber, Lidia Mussie

“…Case presentation A 31-year-old Eritrean female came to our emergency room with severe respiratory distress, persistent retching, drenching sweating, generalized pain and unrecordable blood pressure 12 hours after scorpion sting. Electrocardiography revealed signs of diffuse acute myocarditis. …”
Get full text

Postpartum Exudation of Idiopathic Quiescent Macular Neovascularization: A Narrative Review with a Related Case Report by Livio Vitiello, Maddalena De Bernardo, Ilaria De Pascale, Giulio Salerno, Alfonso Pellegrino, Nicola Rosa

“…The abnormal growth of irregular new blood vessels into the subretinal or intraretinal space is known as macular neovascularization (MNV). …”
Get full text

Matrix Metalloproteinase 9 as Biomarker for Malignant Mammary Tumors in Dogs by Islam S Alani, Huda S Al Biaty

“…We collected tissue samples from mammary glands and blood specimens from 50 dogs suspected of having CMTs and 30 healthy control dogs. …”
Get full text

The Effects of Nebulized Inhaled Triptolide on Airway Inflammation in a Mouse Model of Asthma by Yafang Miao, Li Wei, Hao Chen, Zeming Zhang, Li Han

“…Then bronchoalveolar lavage fluid (BALF), peripheral blood, and lung tissue were collected. Relevant cytokines, transcriptional factors, and CD4+Th17+ T cell proportions were assessed and compared. …”
Get full text

Nursing experience of dressing change at home for a patient with heart failure complicated with pressure injuries (1例心力衰竭合并压力性损伤患者居家换药心得体会)... by ZHANG Fengyao (张凤尧), HOU Pengxiao (侯朋晓), LIU Xueni (刘学妮), WANG Liangmin (王梁敏)

“…The nursing strategy included professional wound evaluation, dressing change, position management, health education, nutrition support, and blood sugar control through the management of lifestyle and diet, creating a good condition for wound healing. …”
Get full text

Effects of High Dietary Inclusion of Defatted Mealworm (Tenebrio molitor) Meal as a Fish Meal Substitute on Growth, Histological Traits, and Health Performances of Rainbow Trout (O... by Md. Sakhawat Hossain, Ali Hamidoghli, Jeongwhui Hong, Wendy Sealey, Brian C. Small

“…Substitution of FM with DMW did not significantly affect hematological electrolyte, acid–base, and blood gas parameters, except for sodium (Na) concentration. …”
Get full text

Bridging Molecular Docking to Molecular Dynamics to Enlighten Recognition Processes of Tailored D-A/D-A-D Types' AIEgens with HSA/BSA by Harun Nalçakan, Gülbin Kurtay

“…In this scope, we performed a detailed molecular dock-ing study of Donor (D)-Acceptor (A) or D-A-D type luminogens with two blood proteins; namely bovine serum albumin (BSA) and human serum albumin (HSA), which appeared as robust carriers of several pharmaceuticals against preliminary cancer diseases. …”
Get full text

A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia by ZHANG Caihui, LIU Liying, ZHANG Zhenjie, WANG Wei, MA Mingsheng, SONG Hongmei

“…Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. …”
Get full text

Net buffer load during regional citrate anticoagulated continuous renal replacement therapy. by Innas Forsal, Dominique Pouchoulin, Viktoria Roos, Jorge Echeverri, Marcus Ewert Broman

“…We could not establish a correlation to steady state arterial bicarbonate. The pre blood pump citrate containing replacement fluid flow rate was affecting net buffer load most of all parts of the dialysis circuit, with a r2 Pearson correlation coefficient of 0.65 (p<0.001).…”
Get full text

GASES SANGUÍNEOS, ELECTROLITOS Y VARIABLES METABÓLICAS DETERMINANTES DEL ESTADO ÁCIDO-BASE EN CABALLOS CRIOLLOS COLOMBIANOS by C. Jaramillo, L. M. Ramírez, M. P. Arias, I. D. Álvarez

“…Se determinaron y compararon los valores de los gases sanguíneos, electrolitos, lactato, hematocrito y estado ácido-base en sangre venosa y arterial de 17 equinos criollos del Centro de Veterinaria y Zootecnia de la Universidad CES, para lo cual se utilizó el sistema Epoc Blood Analysis®, analizador portátil de sangre que permite obtener resultados de gases, iones y metabolitos. …”
Get full text

Post operatory analgesia in caesarean surgery. by Bárbara Lucía Cabezas Poblet, Guyen Cuellar Chang, Rolando T. Espín González, María Antonia Cabezas Poblet

“…This search included 120 patient who were selected to elective iterative caesarean section The variables under study were blood pressure, pulse and respiration during the pre- trans and post operative phases, onset of the anaesthetic effect and its duration, peri operatory complications , quality of the post operatory analgesia and its effect on the newborn measured by using Apgar values . …”
Get full text

The Impact of T Cell Vaccination in Alleviating and Regulating Systemic Lupus Erythematosus Manifestation by Liuye Huang, Yuan Yang, Yu Kuang, Dapeng Wei, Wanyi Li, Qin Yin, Juan Pang, Zhongwei Zhang

“…SLEDAI, clinical symptoms, blood parameters including complements 3 and 4 levels, ANA, and anti-ds-DNA antibodies were tested. …”
Get full text

Reply to: comment on “Early cancer detection by serum biomolecular fingerprinting spectroscopy with machine learning” by Shilian Dong, Dong He, Qian Zhang, Chaoning Huang, Zhiheng Hu, Chenyang Zhang, Lei Nie, Kun Wang, Wei Luo, Jing Yu, Bin Tian, Wei Wu, Xu Chen, Fubing Wang, Jing Hu, Xiangheng Xiao

Get full text

Relation of Asymmetric Dimethylarginine Levels to Macrovascular Disease and Inflammation Markers in Type 2 Diabetic Patients by Mustafa Celik, Serkan Cerrah, Mahmut Arabul, Aysen Akalin

“…We obtained fasting serum and plasma samples and measured HbA1c, fasting blood glucose, C-peptide, creatinine, total cholesterol, triglycerides, HDL cholesterol, LDL cholesterol, hsCRP, fibrinogen, erythrocyte sedimentation rate, total homocysteine, and ADMA levels. …”
Get full text

Investigation of small ruminant lentivirus infections by serological and molecular methods in eastern mediterranean region by Fırat Doğan, Veysel Soydal Ataseven, Seval Bilge Dağalp, Yaşar Ergün

“…<p> <b>Materials and Methods: </b>In this study, leukocyte and blood serum samples were taken from a total of 700 animals, including 260 sheep and 440 goats aged 6 months and over, from public-owned goats and sheep farms collected from the Eastern Mediterranean region (Hatay, Kahramanmaraş and Osmaniye) between 2015-2017 year. …”
Get full text

Hypoglycemic polysaccharides from Auricularia auricula and Auricularia polytricha inhibit oxidative stress, NF-κB signaling and proinflammatory cytokine production in streptozotoci... by Huan Xiang, Dongxiao Sun-Waterhouse, Chun Cui

“…This is the first report to compare the effectiveness of AAP and APP in combating streptozotocin-induced oxidative stress and diabetes-related changes in mice (body weight, fasting blood glucose, serum insulin, proinflammatory mediator and cytokines, oxidative stress-related products, antioxidant enzymes). …”
Get full text

The use of Cattapa Leaves Terminalia cattapa as Preventive and Curative Methods in Patin Catfish Pangasionodon hypophthalmus Infected With Aeromonas hydrophila by D. Wahjuningrum, N. Ashry, Sri Nuryati

“…At the in vivo test, fish were injected intramusculary with TC at the dosages of 60 g/l for the prevention and 120 g/l for curative efficacy. Results from blood picture, clinical sign and mortaliyt showed that TC were better and more effective as preventive than curative for MAS in patin catfish. …”
Get full text

Impact of alcoholic extract from sea cucumber (Holothuria parva) on letrozole–induced polycystic ovary syndrome in adult female rats by Samaneh Askari, Mohammad Reza Jafarzadeh Shirazi, Masoumeh Ahmadi, Arezoo Khoradmehr, Nadiar M. Mussin, Asset A. Kaliyev, Farzad Mohammad Rezazadeh, Mohammad Dadpasand Taromsari, Ali Bustani, Nader Tanideh, Kulyash R. Zhilisbayeva, Amin Tamadon

“…The study spanned four weeks, during which ovarian and uterine tissues were collected for histological examination, and blood samples were collected for hormonal levels. …”
Get full text

Antibodies from a Patient with Type 1 Diabetes and Celiac Disease Bind to Macrophages that Express the Scavenger Receptor CD163 by Brigitte Sonier, Alexander Strom, Gen-Sheng Wang, Christopher Patrick, Jennifer A Crookshank, Majid Mojibian, Amanda J MacFarlane, Fraser W Scott

“…Glo-3A-enriched antibodies bound to a specific subset of cells in the lamina propria of rat jejunum that co-localized mostly with a marker of resident, alternatively activated CD163-positive (CD163+) macrophages. Blood monocytes and macrophage-like cells in human duodenum were also labelled with the enriched antibodies. …”
Get full text