Showing 21 - 40 results of 181 for search '"Phylogenetic tree"', query time: 0.04s Refine Results
  1. 21

    Investigating the formation and evolution of plant diversity patterns in the Qiangtang Plateau based on phylofloristics approach by Xiaoping Li, Yun Han, Lei Miao, Hao Xu, Jingya Yu, Shuang Han, Faqi Zhang

    Published 2025-04-01
    “…We quantified the PD of the Qiangtang Plateau flora utilizing a macro-phylogenetic tree derived from a plant list of 370 species. …”
    Get full text
    Article
  2. 22

    The first complete mitochondrial genome sequence of the common Baya weaverbird (Ploceus philippinus) from southern India by Venkatesh Nagarajan-Radha, Subanithi-Purnima Murugan, Paramanantha Swami Doss Devaraj

    Published 2025-03-01
    “…A maximum-likelihood phylogenetic tree analysis placed P. philippinus and P. nigricollis weaverbirds in a separate clade among other bird species. …”
    Get full text
    Article
  3. 23

    Geoglossum subdifforme sp. nov. and G. simile, Two New Earth Tongues from South Korea by Chang Sun Kim, Young-Nam Kwag, Dae Ho Kim

    Published 2025-01-01
    “…The two species were identified to belong to the genus Geoglossum; the species G. simile and a new species named G. subdifforme sp. nov. The phylogenetic tree constructed using the ITS region showed that G. subdifforme is closely related to G. difforme. …”
    Get full text
    Article
  4. 24

    Review and Phylogenetic Evaluation of Associations between Microdontinae (Diptera: Syrphidae) and Ants (Hymenoptera: Formicidae) by Menno Reemer

    Published 2013-01-01
    “…The taxa of Microdontinae found in association with ants occur scattered throughout their phylogenetic tree. One of the supposedly most basal taxa (Mixogaster) is associated with ants, suggesting that associations with ants evolved early in the history of the subfamily and have remained a predominant feature of their lifestyle. …”
    Get full text
    Article
  5. 25

    Two complete chloroplast genomes of Ceratophyllum, an aquatic genus with unresolved phylogenetic position by Shuangyan Ru, Zhigang Wu, Huijun Wang, Qi Li, Tao Li

    Published 2025-03-01
    “…Ceratophyllum is an aquatic genus noted for its enigmatic position in the angiosperm phylogenetic tree. In this study, we assembled and annotated the chloroplast genomes of two species. …”
    Get full text
    Article
  6. 26

    Sequencing and annotation of the complete mitochondrial genome of a threatened labeonine fish, by Mohammad Nazrul Islam, Shirin Sultana, Md. Jobaidul Alam

    Published 2020-09-01
    “…The complete mitochondrial genome was 16,597 bp in size, which formed a circular double-stranded DNA molecule containing a total of 37 mitochondrial genes (13 protein-coding genes, 2 ribosomal RNA genes, and 22 transfer RNA genes) with two non-coding regions, an origin of light strand replication (OL) and a displacement loop (D-loop), similar structure with other fishes of Teleostei. The phylogenetic tree demonstrated its close relationship with labeonine fishes. …”
    Get full text
    Article
  7. 27

    New Hosts of Simplicimonas similis and Trichomitus batrachorum Identified by 18S Ribosomal RNA Gene Sequences by Kris Genelyn B. Dimasuay, Orlie John Y. Lavilla, Windell L. Rivera

    Published 2013-01-01
    “…Aligned isolate sequences together with retrieved 18S rRNA gene sequences of known trichomonads were utilized to generate phylogenetic trees using maximum likelihood and neighbor-joining analyses. …”
    Get full text
    Article
  8. 28

    The complete chloroplast genome sequence of Lycium barbarum var. implicatum (Solanaceae), a new species of wolfberry from the Yellow River Basin in Ningxia, China by Bo Zhang, Wangsuo Liu, Darifu Ba, Zhiguo Jiang

    Published 2025-01-01
    “…Maximum-likelihood (ML) phylogenetic tree elucidated that L. barbarum var. implicatum was sister to L. ruthenicum. …”
    Get full text
    Article
  9. 29

    Unravelling hybridization in Phytophthora using phylogenomics and genome size estimation by Kris Van Poucke, Annelies Haegeman, Thomas Goedefroit, Fran Focquet, Leen Leus, Marília Horta Jung, Corina Nave, Miguel Angel Redondo, Claude Husson, Kaloyan Kostov, Aneta Lyubenova, Petya Christova, Anne Chandelier, Slavcho Slavov, Arthur de Cock, Peter Bonants, Sabine Werres, Jonàs Oliva Palau, Benoit Marçais, Thomas Jung, Jan Stenlid, Tom Ruttink, Kurt Heungens

    Published 2021-07-01
    “…Hybrid species were subsequently connected to their progenitors in this phylogenetic tree. In this study we demonstrate the application of two validated techniques (GBS and flow cytometry) for relatively low cost but high resolution identification of hybrids and their phylogenetic relations.…”
    Get full text
    Article
  10. 30

    Molecular Markers for the Phylogenetic Reconstruction of <i>Trypanosoma cruzi</i>: A Quantitative Review by David Ramírez-Delgado, Carlos Alberto Flores-López

    Published 2025-01-01
    “…Although the mini-exon gene is by far the locus that has been most widely used, it is not the most appropriate marker for the typification of <i>T. cruzi</i> based on the construction of a resolved phylogenetic tree. Overall, the mitochondrial COII-NDI locus stands out as the best molecular marker for this purpose, followed by the Cytochrome b and the Lathosterol oxidase genes.…”
    Get full text
    Article
  11. 31

    New tribe-level classification of Hypostominae (Loricariidae) based on optimization of morphological states on DNA-based relationships, with descriptions of three new tribes and tw... by Jonathan W. Armbruster, Nathan K. Lujan

    Published 2025-01-01
    “…We re-optimized morphological character-state change by mapping states previously used to infer evolutionary history onto a composite phylogenetic tree inferred from DNA-sequence data. This revealed the strong influence on morphology-based phylogenies of a correlated suite of opercular character states related to the mechanism for cheek odontode eversion. …”
    Get full text
    Article
  12. 32

    From museum drawer to tree: Historical DNA phylogenomics clarifies the systematics of rare dung beetles (Coleoptera: Scarabaeinae) from museum collections. by Fernando Lopes, Nicole Gunter, Conrad P D T Gillett, Giulio Montanaro, Michele Rossini, Federica Losacco, Gimo M Daniel, Nicolas Straube, Sergei Tarasov

    Published 2024-01-01
    “…We obtained high-quality DNA from all studied specimens to enable the generation of a UCE-based dataset that revealed an insightful and well-supported phylogenetic tree of dung beetles. The resulting phylogeny propounded the reclassification of Onychothecus (previously incertae sedis) within the tribe Coprini. …”
    Get full text
    Article
  13. 33

    Modeling the Phylogenetic Rates of Continuous Trait Evolution: An Autoregressive–Moving-Average Model Approach by Dwueng-Chwuan Jhwueng

    Published 2024-12-01
    “…Various statistical models have been developed to estimate the rates of continuous trait evolution for a group of related species evolving along a phylogenetic tree. Existing models often assume the independence of the rate parameters; however, this assumption may not account for scenarios where the rate of continuous trait evolution correlates with its evolutionary history. …”
    Get full text
    Article
  14. 34

    Genome-wide analysis and characterization of TPD1 family proteins in pearl millet (Cenchrus americanus): Insights into reproductive regulation and phytohormone responses. by Zainab M Almutairi

    Published 2025-01-01
    “…Screening of cis-elements in the promoter of CaTPD1s revealed various cis-elements related to phytohormone regulation, wound response, abiotic stress defense, and light response. The phylogenetic tree revealed distinct clustering of CaTPD1_Ch6 and CaTPD1_Ch5 among the other CaTPD1s, which revealed close relationships with the orthologs from Arabidopsis and rice that are known to have a critical role in tapetum development and pollen and ovule production. …”
    Get full text
    Article
  15. 35

    Cloning, Characterization and Expression Pattern of the Ovarian Cytochrome P450 Cyp19a1aGene in Gonadal Developmental Period of Cobaltcap Silverside Hypoatherina tsurugae by Dilip Kumar Bej

    Published 2025-01-01
    “…It consists of an open reading frame (ORF) of 1551 bp that encodes a 517 aa protein, found to be identical to the sequence of other fish species. A phylogenetic tree was constructed by comparing the mRNA sequence of 41 different fishes across various taxa available in the NCBI database and using an outgroup as Acipenser sinensis. …”
    Get full text
    Article
  16. 36

    Application of internal transcribed spacer (ITS) sequences for identifying Anoectochilus setaceus Blume in Thanh Hoa, Vietnam by B. B. Thinh, L. D. Chac, L. T.M. Thu

    Published 2020-06-01
    “…This genetic sequence was analyzed, compared and used to establish a phylogenetic tree using BioEdit, BLAST and DNASTAR programs.Results and conclusion. …”
    Get full text
    Article
  17. 37

    Tumor-initiating and metastasis-initiating cells of clear-cell renal cell carcinoma by Dinh-Xuan Pham, Tien Hsu

    Published 2025-02-01
    “…MICs result from various genetic changes during subclonal evolution, while TICs reside in the stem of the ccRCC phylogenetic tree of clonal development. TICs likely originate from kidney tubule progenitor cells bearing VHL gene inactivation, including chromatin 3p loss. …”
    Get full text
    Article
  18. 38

    Complete mitochondrial genome assembly and comparative analysis of Colocasia esculenta by Huinan Li, Lili Liu, Zuyang Qiu, Fanglian He, Weiqing Dong

    Published 2025-01-01
    “…Finally, based on 28 representative plant species, a phylogenetic tree was constructed, revealing a close relationship between C. esculenta and Araceae. …”
    Get full text
    Article
  19. 39

    Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq by Berivan A. Latef, Luay A. Ali

    Published 2024-12-01
    “…PCR product of COI was sequenced using forward primer COI F 5'(ACCCGCTGAATTTAAGCAT)3' and reverse primer COIR 5'( CTCTTCAGATACTTTTCAAC) 3' then registered  in the GenBank database with their accession numbers. The phylogenetic tree was constructed; the studied species were recognized (as new records to the Iraqi fauna of ostracods) and described from Iraq for the first time. …”
    Get full text
    Article
  20. 40

    Geology and climate drive alpine plant compositional variation among peaks in the Cascade Range of Washington. by Erik W Ertsgaard, Nicholas L Gjording, Jonathan D Bakker, Joseph A Kleinkopf, David E Giblin

    Published 2025-01-01
    “…We documented an average of 54 species per peak and used our overall inventory of 307 taxa to construct a phylogenetic tree for the entire mountain range plant community sampled. …”
    Get full text
    Article