Foreword

“…This issue begins with YOON Sang-seok’s “The Use of the Honorific Suffix -‍si- for Non-human Subjects: An Analysis of Talk-shows,” which examines pragmatic nuances in the misuse of honorifics, shedding light on broader social tendencies. Following this, Maša ŽBOGAR’s “An Overview of Korean Case Marker Alterations: Focusing on the eul/reul 을/를 – i/ga 이/가 Alteration” investigates the substitution of accusative and nominative markers in specific constructions, offering fresh perspectives on Korean grammar. …”
Get full text

Extreme migratory connectivity and apparent mirroring of non-breeding grounds conditions in a severely declining breeding population of an Afro-Palearctic migratory bird by Máire Kirkland, Nathaniel N. D. Annorbah, Lee Barber, John Black, Jeremy Blackburn, Michael Colley, Gary Clewley, Colin Cross, Mike Drew, Oliver J. L. Fox, Vicky Gilson, Steffen Hahn, Chas Holt, Mark F. Hulme, John Jarjou, Dembo Jatta, Emmanuel Jatta, Kevin Leighton, Ernestina Mensah-Pebi, Chris Orsman, Naffie Sarr, Roger Walsh, Leo Zwarts, Robert J. Fuller, Philip W. Atkinson, Chris M. Hewson

“…Non-breeding population dispersion is lower than for previously tracked populations of this and other species and likely lower than can usually be detected by light-level geolocation, the main tracking method for small bodied species. …”
Get full text

Photoprotective Effect of the Plant Collaea argentina against Adverse Effects Induced by Photodynamic Therapy by Leandro Mamone, Daniel Sáenz, Pablo Vallecorsa, Alcira Batlle, Adriana Casas, Gabriela Di Venosa

“…Photodynamic therapy (PDT) is a treatment modality for tumours and other accessible lesions based on the combination of light and a photosensitizer (PS) accumulated in the target tissue. …”
Get full text

Giant Photoluminescence Enhancement of Ga‐Doped ZnO Microwires by X‐Ray Irradiation by Siyuan He, Shuiyan Cao, Ying Liu, Wenfa Chen, Pin Lyu, Weidian Li, Jincheng Bao, Wenhui Sun, Caixia Kan, Mingming Jiang, Yanpeng Liu

“…Abstract Ga‐doped zinc oxide (ZnO) microwires hold great promise for developing highly efficient light sources because of the wide bandgap with proper exciton binding energy. …”
Get full text

Análisis de la irradiancia de unidades de fotocurado LED utilizando diferentes radiómetros dentales portátiles by Matias Mederos, Andrés García, Elisa de León Cáceres, Carlos Cuevas-Suárez, Guillermo Grazioli

“…La intensidad de la luz (mW/cm²) se evaluó utilizando seis radiómetros dentales portátiles diferentes, 4 digitales (Bluephase meter A- D1, Bluephase meter B - D2, Levchen light meter - D3, Genérico -D4) y 2 analógicos (Genérico - A1, Demetron - A2).  …”
Get full text

Impact of periprocedural factors on revascularization success and good clinical outcomes in anterior circulation stroke patients treated with mechanical thrombectomy by M. Kurminas, A. Berūkštis, N. Misonis, A. E. Tamošiūnas, D. Jatužis

“…Constantly evolving guidelines for the treatment of ischemic stroke in light of widely published clinical trials show no final consensus; many factors that may significantly alter treatment outcomes are still under investigation. …”
Get full text

Design and Experimental Research on a Chisel-Type Variable Hierarchical Deep Fertilization Device Suitable for Saline–Alkali Soil by Nan Xu, Zhenbo Xin, Jin Yuan, Zenghui Gao, Yu Tian, Chao Xia, Xuemei Liu, Dongwei Wang

“…To optimize the fertilizer utilization rate in coastal saline–alkali soils and substantially reduce fertilizer waste, it is imperative to transport fertilizers to the deep soil layers and execute layered variable-rate fertilization. In light of this, a chisel-type variable-rate layered electronically controlled deep-fertilization device specifically designed for saline–alkali soils has been developed. …”
Get full text

Clinical Features of Combined Central Retinal Artery and Vein Occlusion by Hao Wang, Yongye Chang, Fen Zhang, Rong Yang, Suxia Yan, Jieying Dong, Minglian Zhang, Shaomin Peng

“…At presentation, BCVA of the involved eyes ranged from no light perception (NLP) to 20/20. In addition, 45.5% (15/33) of the eyes had BCVA of finger counting (FC) or below, whereas 12.1% (4/33) had BCVA of 20/60 or above. …”
Get full text

The Timing and Spectral Properties of the 2022 Outburst of SGR J1935+2154 Observed with NICER by Fu Yu-Cong, Lin Lin, Ge Ming-Yu, Enoto Teruaki, Hu Chin-Ping, Younes George, Göǧüş Ersin, Malacaria Christian

“…While a flare is evident on the light curve, a fast radio burst (FRB) was detected immediately following the peak of this flare. …”
Get full text

Sorafenib enhanced the function of myeloid-derived suppressor cells in hepatocellular carcinoma by facilitating PPARα-mediated fatty acid oxidation by Chunxiao Li, Liting Xiong, Yuhan Yang, Ping Jiang, Junjie Wang, Mengyuan Li, Shuhua Wei, Suqing Tian, Yuexuan Wang, Mi Zhang, Jie Tang

“…Conclusion Overall, our study demonstrated that sorafenib enhanced the function of MDSCs by facilitating PPARα-mediated FAO and further augmenting sorafenib resistance, which sheds light on dietary management and improves the therapeutic response in HCC.…”
Get full text

Looking at Infrared Background Radiation Anisotropies with Spitzer: Large-scale Anisotropies and Their Implications by A. Kashlinsky, Richard G. Arendt, M. L. N. Ashby, J. Kruk, N. Odegard

“…We discuss the proposed theories for the origin of the excess CIB anisotropies in light of the new data. Out of these, the model where the CIB fluctuation excess originates from the granulation power due to LIGO-observed primordial black holes as dark matter appears most successful in accounting for all observations related to the measured CIB power amplitude and spatial structure, including the measured coherence between the CIB and unresolved cosmic X-ray background (CXB). …”
Get full text

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Get full text

Identifying Digital Markers of Attention-Deficit/Hyperactivity Disorder (ADHD) in a Remote Monitoring Setting: Prospective Observational Study by Heet Sankesara, Hayley Denyer, Shaoxiong Sun, Qigang Deng, Yatharth Ranjan, Pauline Conde, Zulqarnain Rashid, Philip Asherson, Andrea Bilbow, Madeleine J Groom, Chris Hollis, Richard J B Dobson, Amos Folarin, Jonna Kuntsi

“…We focus on features derived from (1) Active App (mean and SD of questionnaire notification response latency and of the time interval between questionnaires), (2) Passive App (daily mean and SD of response time to social and communication app notifications, the SD in ambient light during phone use, total phone use time, and total number of new apps added), and (3) a wearable device (Fitbit) (daily steps taken while active on the phone). …”
Get full text

Development of a Solar-Powered Edge Processing Perimeter Alert System with AI and LoRa/LoRaWAN Integration for Drone Detection and Enhanced Security by Mateo Mejia-Herrera, Juan Botero-Valencia, José Ortega, Ruber Hernández-García

“…Additionally, the DC magnetic field is measured to identify possible sensor movements or changes caused by large bodies, and a configurable RGB light signal visually indicates motion or sound detection. …”
Get full text

Blood biomarkers for vascular cognitive impairment based on neuronal function: a systematic review and meta-analysis by Weiquan Huang, Libin Liao, Qian Liu, Rongchao Ma, Xuan He, Xuan He, Xiaoqiong Du, Dujuan Sha, Dujuan Sha, Dujuan Sha, Dujuan Sha

“…The nine peripheral biomarkers analyzed for their association with neuronal function include amyloid beta 42 (Aβ42), amyloid beta 40 (Aβ40), Aβ42/Aβ40 ratio, total Tau (t-Tau), phosphorylated tau 181 (p-tau 181), neurofilament light (NfL), brain-derived neurotrophic factor (BDNF), S100B, and soluble receptor for advanced glycation end products (sRAGE). …”
Get full text

Microstructural modifications in bitumens rejuvenated by oil from pyrolysis of waste tires by Michela Alfe, Valentina Gargiulo, Giovanna Ruoppolo, Francesco Cammarota, Pietro Calandra, Cesare Oliviero Rossi, Valeria Loise, Michele Porto, Roberto Di Capua, Paolino Caputo

“…The physicochemical mechanisms of this phenomenon are proposed in light of the oil characteristics. Hence, it is concluded that the pyrolysis oil from WTs can be used to rejuvenate asphalts, which can then be used in reclaimed asphalt pavement technology. …”
Get full text

Polydomus karssenii gen. nov. sp. nov. is a dark septate endophyte with a bifunctional lifestyle parasitising eggs of plant parasitic cyst nematodes (Heterodera spp.) by Samad Ashrafi, Jan-Peer Wennrich, Yvonne Becker, Jose G. Maciá-Vicente, Anke Brißke-Rode, Matthias Daub, Torsten Thünen, Abdelfattah A. Dababat, Maria R. Finckh, Marc Stadler, Wolfgang Maier

“…The pathogenicity tests against nematode eggs fulfilled Koch’s postulates using in vitro nematode bioassays and showed that the fungus could parasitise its original nematode host H. filipjevi as well as the sugar beet cyst nematode H. schachtii, and colonise cysts and eggs of its hosts by forming highly melanised moniliform hyphae. Light microscopic observations on fungus-root interactions in an axenic system revealed the capacity of the same fungal strain to colonise the roots of wheat and produce melanised hyphae and microsclerotia-like structure typical for dark septate endophytes. …”
Get full text

Strategic bioprocessing of A. protothecoides and C. sorokiniana using renewable feedstocks for targeted bioproduct and biodiesel generation by Eleni Krikigianni, Kyriakos Antoniadis, Paul Christakopoulos, Ulrika Rova, Leonidas Matsakas, Alok Patel

“…To address this, an integrated, strain-specific approach was used to evaluate key cultivation parameters (nitrogen source, C/N ratio, and light intensity) as their interactions affect growth performance and biochemical composition. …”
Get full text

Determination of Punicalagins Content, Metal Chelating, and Antioxidant Properties of Edible Pomegranate (Punica granatum L) Peels and Seeds Grown in Morocco by Talal Sabraoui, Taleb Khider, Boubker Nasser, Rabiaa Eddoha, Abderrahman Moujahid, Maryam Benbachir, Abdelkhalid Essamadi

“…According to achieved results, high antioxidant capacity of pomegranate extracts, especially peel, shed light to further use as natural food preservatives. …”
Get full text

Transcranial photobiomodulation for reducing symptoms of autism spectrum disorder and modulating brain electrophysiology in children aged 2–7: an open label study by Yuli Fradkin, Joaquin A. Anguera, Alexander J. Simon, Luis De Taboada, Eugenia Steingold

“…We delivered non-invasively to all participants pulses of near-infrared light (wavelength 850 nm, pulse 40 Hz) to cortical nodes of Default Mode Network, Broca and Wernicke areas, and occipital lobe of the brain, twice weekly for 10 weeks. …”
Get full text