Pastoreo de becerros en pradera de estrella de África (Cynodon plectostachyus) suplementados con alimento comercial by Herminio Aniano Aguirre, María de los Ángeles Maldonado-Peralta, Adelaido Rafael Rojas-García, Eugenia Teresa Lozano-Aguirre, José Antonio Hernández-Marín, Leopoldo Jorge-Castañeda

Get full text

Frecuencia del Síndrome de anticuerpos Anti-fosfolípidos y su clasificación según los nuevos criterios EULAR 2023 en pacientes con Lupus Eritematoso Sistémico, que consultaron en e... by Dora Montiel, Margarita Samudio

“…De los mismos, 13 pacientes (18.5%) presentaron anticuerpos antifosfolipídicos. De acuerdo a los nuevos criterios en la cohorte de validación clasificaron como SAF: 5 pacientes (7.1%). …”
Get full text

Вдосконалення вузла подавання армуючого волокна для 3D‑друку виробів з композиційним армуванням by Максим Сіренко, Олена Карпович

Get full text

ARAHAN PENGEMBANGAN PARIWISATA DI KECAMATAN DUSUN SELATAN, KABUPATEN BARITO SELATAN PROPINSI KALIMANTAN TENGAH by AZARINE HANA BASTIYANI, IRA SAFITRI

Get full text

پهنه‌بندی و تحلیل ژئومورفولوژیکی سیلاب رودخانه دینور (استان کرمانشاه) با استفاده از مدل هیدرولیکی HEC-RAS... by رویا پناهی, محمد مهدی حسین زاده

Get full text

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of &#x003E; 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of <mml:math alttext="chem{O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math> and 2-mercaptoethanol or in the presence of <mml:math alttext="chem{H_{2}O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> <mml:msub> <mml:mtext>H</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math>. …”
Get full text

Sex differences in the neuroinflammatory signaling pathway: effect of miRNAs on fatty acid synthesis in microglia by Haolin Zheng, Akiko Mizokami, Sergio Romera-Giner, Jaime Llera-Oyola, Yosuke Yamawaki, Tomomi Sano, Eijiro Jimi, Francisco García-García, Takashi Kanematsu

“…Recent studies have demonstrated that microglia, the primary innate immune cells in the brain, play a crucial role in AD development. Therefore, this study aimed to explore sex differences in microglial function, specifically focusing on the role of testosterone in miRNA-mediated regulation of microglial gene expression. …”
Get full text

TREM-1 and TREM-2 Expression on CD14+ Cells in Bronchoalveolar Lavage Fluid in Pulmonary Sarcoidosis and Hypersensitivity Pneumonitis in the Context of T Cell Immune Response by M. Suchankova, J. Urban, M. Ganovska, E. Tibenska, K. Szaboova, E. Tedlova, F. Sandor, I. Majer, M. Bobovcak, I. Jonner, B. Konig, M. Bucova

“…Flow cytometry was performed to analyse TREM-1 and TREM-2 expression on CD14+ cells in bronchoalveolar lavage fluid from patients having sarcoidosis or HP and a control group. Results. The study proved increased TREM-1 expression on alveolar macrophages in pulmonary sarcoidosis and diminished TREM-1 expression in HP-Sarcoidosis: median: 76.7; HP: median: 29.9; control: median: 53.3, (sarcoidosis versus HP: p<0.001; sarcoidosis versus control: p<0.05). …”
Get full text

Comparative genomics reveals low levels of inter- and intraspecies diversity in the causal agents of dwarf and common bunt of wheat and hint at conspecificity of Tilletia caries an... by Somayyeh Sedaghatjoo, Bagdevi Mishra, Monika K. Forster, Yvonne Becker, Jens Keilwagen, Berta Killermann, Marco Thines, Petr Karlovsky, Wolfgang Maier

“…Despite the conspicuously different teliospore ornamentation of T. caries and T. laevis, a high degree of genomic identity and scarcity of species-specific genes indicate that the two species could be conspecific.…”
Get full text

Recomendaciones sobre vacunación en niños y adolescentes con errores innatos de la inmunidad según el programa ampliado de inmunización colombiano by Nathalia Cortés-Marín, Luis Miguel Sosa-Ávila, Andrés Felipe Arias, Leonardo David Escobar-Cortés, Juan Pablo Rojas-Hernández

“…Se contemplaron los errores de la inmunidad más comunes a nivel global y las vacunas incluidas en el PAI colombiano, para evitar retrasos en los esquemas de vacunación. …”
Get full text

Ginkgo biloba extract EGb761 mitigates ischemic stroke via metabolic pathway modulation by Xiaoyao Liu, Yuan Tian, Wenhui Xu, Yuxi Wang, Zhen Liu, Yuncheng Ma, Weiling Wang, Jian Gao, Ting Wang

Get full text

Структура та фазовий склад плівок Fe–Si–B-Cu–Nb та Fe–Si–B-Ni–Mo by Сергій Рябцев, Олександр Кушнерьов, Валерій Башев

“…У роботі визначено умови отримання плівок з низькими значеннями температурного коефіцієнта електричного опору (-0.000009)·1/K та коерцитивної сили (HC ~ 11 A/m). …”
Get full text

Microstructural modifications in bitumens rejuvenated by oil from pyrolysis of waste tires by Michela Alfe, Valentina Gargiulo, Giovanna Ruoppolo, Francesco Cammarota, Pietro Calandra, Cesare Oliviero Rossi, Valeria Loise, Michele Porto, Roberto Di Capua, Paolino Caputo

Get full text

Fire-driven disruptions of global soil biochemical relationships by Guiyao Zhou, Nico Eisenhauer, Zhenggang Du, Manuel Esteban Lucas-Borja, Kaiyan Zhai, Miguel Berdugo, Huimin Duan, Han Wu, Shengen Liu, Daniel Revillini, Tadeo Sáez-Sandino, Hua Chai, Xuhui Zhou, Manuel Delgado-Baquerizo

“…Our work provides evidence that fire decouples soil biogeochemistry globally and helps to identify high-priority ecosystems where critical components of soil biogeochemistry are especially unbalanced by fire, which is fundamental for the management of ecosystems in a world subjected to more severe, recurrent, and further-reaching wildfires.…”
Get full text

Determination of Punicalagins Content, Metal Chelating, and Antioxidant Properties of Edible Pomegranate (Punica granatum L) Peels and Seeds Grown in Morocco by Talal Sabraoui, Taleb Khider, Boubker Nasser, Rabiaa Eddoha, Abderrahman Moujahid, Maryam Benbachir, Abdelkhalid Essamadi

“…Pomegranate peels showed significantly (p<0.05) high antioxidant activity 1-diphenyl-2-picrylhydrazyl (DPPH) EC50: 42.71±0.04 μg/mL, 2.2′-Azino-bis(3-Ethylbenzothiazoline-6-Sulfonic Acid) (ABTS) EC50: 62.15±0.01 μg/mL), and chelating activity (FRAP 1.85±0.00 mg ascorbic acid equivalents/100 g, Fe2+: 2.52±0.01 μmol EDTA equivalents/g dw) compared to seeds. A positive correlation between antioxidant activity and total phenolic was found. …”
Get full text

18F-FDG PET/CT assessment of metabolic tumor burden predicts survival in patients with metastatic posterior uveal melanoma by Tine Gadegaard Hindso, Torben Martinussen, Camilla Wium Bjerrum, Sune Høgild Keller, Annika Loft, Mette Bagger Sjøl, Kristoffer Nissen, Carsten Faber, Marco Donia, Inge Marie Svane, Eva Ellebaek, Steffen Heegaard, Jens Folke Kiilgaard, Karine Madsen

“…In conclusion, MTV and TLG were found to be better predictors of survival in metastatic PUM than the AJCC staging system, but when LDLM was used as a continuous variable it showed an equally good prediction of 1-year survival.…”
Get full text

Sperm quality of Litopenaeus vannamei broostock injected by PMSG and antidopamin by Fahmi Akbar, Agus Oman Sudrajat, Siti Subaidah

Get full text

شناسایی و اولویت‌بندی تهدیدات جوی مؤثر بر آمادگی رزمی یگان‌های نظامی منطقه جنوب شرق by محمد محمدی, محمدحسین ناصرزاده, بهلول علیجانی, حسن قاضی

Get full text

Analgesic, Anti-Inflammatory, and Antioxidant Activities of Byrsonima duckeana W. R. Anderson (Malpighiaceae) by Maria Christina dos Santos Verdam, Fernanda Guilhon-Simplicio, Kleyton Cardoso de Andrade, Karina Lorena Meira Fernandes, Tallita Marques Machado, Felipe Moura Araújo da Silva, Mayane Pereira de Souza, Hector Henrique Ferreira Koolen, Cristiane da Silva Paula, Beatriz Cristina Konopatzki Hirota, Vinícius Bednarczuk de Oliveira, Cristina Mayumi Sasaki Miyazaki, Milena Kalegari, Marilis Dallarmi Miguel, Patricia Maria Stuelp-Campelo, Obdulio Gomes Miguel

“…Background. Byrsonima is a promising neotropical genus, rich in flavonoids and triterpenes, with several proven pharmacological properties. …”
Get full text

Características clínico-epidemiológicas del síndrome coronario agudo by Denia Bonilla Padrón, Annia María Carrero, Yanitsy Chipi Rodríguez, Sonia María Sánchez Valcarcel, Daniel Silva Brito

“…<strong>Fundamento:</strong> las enfermedades cardiovasculares se consideran un problema de salud a nivel mundial, entre ellas, el infarto agudo de miocardio ocupa un lugar relevante y representa una de las primeras causas de muerte en la mayoría de los países. …”
Get full text