Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

<p>Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Me...

Full description

Saved in:
Bibliographic Details
Format: Article
Language:English
Published: Wiley 2006-01-01
Series:Bioinorganic Chemistry and Applications
Online Access:http://www.hindawi.com/GetArticle.aspx?doi=10.1155/BCA/2006/63703
Tags: Add Tag
No Tags, Be the first to tag this record!
_version_ 1832559485551378432
collection DOAJ
description <p>Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen <mml:math alttext="$^{1}$chem{O_{2}}"> <mml:mrow> <mml:msup> <mml:mi/> <mml:mn>1</mml:mn> </mml:msup> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:mrow> </mml:math>, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (<mml:math alttext="$^{cdot}$chem{{O_{2}}^{-}}"> <mml:msup> <mml:mi/> <mml:mo>&#x22C5;</mml:mo> </mml:msup> <mml:msubsup> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> <mml:mo>&#x2212;</mml:mo> </mml:msubsup> </mml:math>, <mml:math alttext="chem{H_{2}O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> <mml:msub> <mml:mtext>H</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math>, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of &#x003E; 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of <mml:math alttext="chem{O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math> and 2-mercaptoethanol or in the presence of <mml:math alttext="chem{H_{2}O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> <mml:msub> <mml:mtext>H</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math>. Under both sensitized and catalyzed conditions, the nucleotides <mml:math alttext="G$^{13}$"> <mml:msup> <mml:mtext>G</mml:mtext> <mml:mrow> <mml:mn>13</mml:mn> </mml:mrow> </mml:msup> </mml:math>&#8211;<mml:math alttext="G$^{15}$"> <mml:msup> <mml:mtext>G</mml:mtext> <mml:mrow> <mml:mn>15</mml:mn> </mml:mrow> </mml:msup> </mml:math> were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.</p>
format Article
id doaj-art-4cd88fb990bb4cf082f6bdeaea752da1
institution Kabale University
issn 1565-3633
language English
publishDate 2006-01-01
publisher Wiley
record_format Article
series Bioinorganic Chemistry and Applications
spelling doaj-art-4cd88fb990bb4cf082f6bdeaea752da12025-02-03T01:29:56ZengWileyBioinorganic Chemistry and Applications1565-36332006-01-012006Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification<p>Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen <mml:math alttext="$^{1}$chem{O_{2}}"> <mml:mrow> <mml:msup> <mml:mi/> <mml:mn>1</mml:mn> </mml:msup> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:mrow> </mml:math>, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (<mml:math alttext="$^{cdot}$chem{{O_{2}}^{-}}"> <mml:msup> <mml:mi/> <mml:mo>&#x22C5;</mml:mo> </mml:msup> <mml:msubsup> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> <mml:mo>&#x2212;</mml:mo> </mml:msubsup> </mml:math>, <mml:math alttext="chem{H_{2}O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> <mml:msub> <mml:mtext>H</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math>, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of &#x003E; 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of <mml:math alttext="chem{O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math> and 2-mercaptoethanol or in the presence of <mml:math alttext="chem{H_{2}O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> <mml:msub> <mml:mtext>H</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math>. Under both sensitized and catalyzed conditions, the nucleotides <mml:math alttext="G$^{13}$"> <mml:msup> <mml:mtext>G</mml:mtext> <mml:mrow> <mml:mn>13</mml:mn> </mml:mrow> </mml:msup> </mml:math>&#8211;<mml:math alttext="G$^{15}$"> <mml:msup> <mml:mtext>G</mml:mtext> <mml:mrow> <mml:mn>15</mml:mn> </mml:mrow> </mml:msup> </mml:math> were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.</p>http://www.hindawi.com/GetArticle.aspx?doi=10.1155/BCA/2006/63703
spellingShingle Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
Bioinorganic Chemistry and Applications
title Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
title_full Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
title_fullStr Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
title_full_unstemmed Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
title_short Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
title_sort conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic dna modification
url http://www.hindawi.com/GetArticle.aspx?doi=10.1155/BCA/2006/63703

Similar Items