Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
<p>Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Me...
Saved in:
| Format: | Article |
|---|---|
| Language: | English |
| Published: |
Wiley
2006-01-01
|
| Series: | Bioinorganic Chemistry and Applications |
| Online Access: | http://www.hindawi.com/GetArticle.aspx?doi=10.1155/BCA/2006/63703 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| Summary: | <p>Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen <mml:math alttext="$^{1}$chem{O_{2}}"> <mml:mrow> <mml:msup> <mml:mi/> <mml:mn>1</mml:mn> </mml:msup> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:mrow> </mml:math>, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (<mml:math alttext="$^{cdot}$chem{{O_{2}}^{-}}"> <mml:msup> <mml:mi/> <mml:mo>⋅</mml:mo> </mml:msup> <mml:msubsup> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> <mml:mo>−</mml:mo> </mml:msubsup> </mml:math>, <mml:math alttext="chem{H_{2}O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> <mml:msub> <mml:mtext>H</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math>, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of <mml:math alttext="chem{O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math> and 2-mercaptoethanol or in the presence of <mml:math alttext="chem{H_{2}O_{2}}"> <mml:msub> <mml:mtext>O</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> <mml:msub> <mml:mtext>H</mml:mtext> <mml:mn>2</mml:mn> </mml:msub> </mml:math>. Under both sensitized and catalyzed conditions, the nucleotides <mml:math alttext="G$^{13}$"> <mml:msup> <mml:mtext>G</mml:mtext> <mml:mrow> <mml:mn>13</mml:mn> </mml:mrow> </mml:msup> </mml:math>–<mml:math alttext="G$^{15}$"> <mml:msup> <mml:mtext>G</mml:mtext> <mml:mrow> <mml:mn>15</mml:mn> </mml:mrow> </mml:msup> </mml:math> were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.</p> |
|---|---|
| ISSN: | 1565-3633 |